EMAIL THIS PAGE TO A FRIEND

PAX8

paired box 8

Gene ID:
Human(7849) Summary: This gene encodes a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins that contain a paired box domain, an octapeptide, and a paired-type homeodomain. This nuclear protein is involved in thyroid follicular cell development and expression of thyroid-specific genes. Mutations in this gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Mouse(18510) paired box gene 8
Rat(81819) paired box 8
Zebrafish(60637) paired box gene 8
cow(534661) paired box 8
dog(403927) paired box 8
sheep(101105489) paired box 8
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34686 Anti-PAX5 antibody produced in rabbit affinity isolated antibody mouse, canine, rat, horse, zebrafish, guinea pig, rabbit, human
immunohistochemistry, western blot pricing
A2234 Anti-PAX8 (191-205) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A2359 Anti-PAX8 (241-255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500756 Anti-PAX8 (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412094 ANTI-PAX8 antibody produced in mouse clone 3E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412095 ANTI-PAX8 antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412096 ANTI-PAX8 antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412097 ANTI-PAX8 antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412166 ANTI-PAX8 antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412449 ANTI-PAX8 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412604 ANTI-PAX8 antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV48088 Anti-PAX8 antibody produced in rabbit affinity isolated antibody , human, mouse, rat, horse, zebrafish, rabbit, guinea pig, canine
western blot pricing
HPA030062 Anti-PAX8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104465 Anti-PAX8 antibody produced in rabbit affinity isolated antibody canine, rat, horse, human, guinea pig, mouse, rabbit
western blot pricing
SAB2701976 Anti-PAX8 antibody produced in rabbit human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB2106325 Anti-PAX8 antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit, guinea pig, human
ELISA, western blot pricing
HPA064554 Anti-PAX8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2500757 Anti-PAX8, N-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
WH0007849M3 Monoclonal Anti-PAX8 antibody produced in mouse clone 3B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404559 Monoclonal Anti-PAX8 antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003466 Rosetta Predictions human pricing
NM_013951 Rosetta Predictions human pricing
NM_013952 Rosetta Predictions human pricing
NM_013953 Rosetta Predictions human pricing
NM_013992 Rosetta Predictions human pricing
NM_031141 Rosetta Predictions rat pricing
NM_011040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211299 predicted 575
2 SASI_Hs01_00211300 predicted 1706
3 SASI_Hs01_00211302 predicted 1924
4 SASI_Hs01_00211303 predicted 558
5 SASI_Hs01_00211304 predicted 1705
6 SASI_Hs02_00335720 predicted 565
7 SASI_Hs01_00211305 predicted 529
8 SASI_Hs01_00211306 predicted 1584
9 SASI_Hs01_00211307 predicted 1923
10 SASI_Hs01_00211308 predicted 1751
11 SASI_Hs01_00211301 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216953 predicted 573
2 SASI_Hs01_00216954 predicted 1518
3 SASI_Hs01_00216956 predicted 1735
4 SASI_Hs01_00216957 predicted 559
5 SASI_Hs01_00216958 predicted 1518
6 SASI_Hs02_00344891 predicted 560
7 SASI_Hs01_00216959 predicted 530
8 SASI_Hs01_00216960 predicted 1395
9 SASI_Hs01_00216961 predicted 1740
10 SASI_Hs01_00216962 predicted 1559
11 SASI_Hs01_00216955 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072220 predicted 573
2 SASI_Hs01_00072221 predicted 1630
3 SASI_Hs01_00072223 predicted 1848
4 SASI_Hs01_00072224 predicted 557
5 SASI_Hs01_00072225 predicted 1624
6 SASI_Hs02_00344892 predicted 557
7 SASI_Hs01_00072226 predicted 525
8 SASI_Hs01_00072227 predicted 1501
9 SASI_Hs01_00072228 predicted 1843
10 SASI_Hs01_00072229 predicted 1666
11 SASI_Hs01_00072222 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014924 predicted 574
2 SASI_Hs01_00014925 predicted 1394
3 SASI_Hs01_00014927 predicted 1610
4 SASI_Hs01_00014928 predicted 559
5 SASI_Hs01_00014929 predicted 1391
6 SASI_Hs02_00344893 predicted 557
7 SASI_Hs01_00014930 predicted 525
8 SASI_Hs01_00014931 predicted 1277
9 SASI_Hs01_00014932 predicted 1616
10 SASI_Hs01_00014933 predicted 1441
11 SASI_Hs01_00014926 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073371 predicted 579
2 SASI_Hs01_00073372 predicted 1299
3 SASI_Hs01_00073374 predicted 1507
4 SASI_Hs01_00073375 predicted 559
5 SASI_Hs01_00073376 predicted 1294
6 SASI_Hs02_00344954 predicted 557
7 SASI_Hs01_00073377 predicted 524
8 SASI_Hs01_00073378 predicted 1167
9 SASI_Hs01_00073379 predicted 1517
10 SASI_Hs01_00073380 predicted 1341
11 SASI_Hs01_00073373 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093669 predicted 876
2 SASI_Rn01_00093670 predicted 331
3 SASI_Rn01_00093671 predicted 1599
4 SASI_Rn02_00264477 predicted 1610
5 SASI_Rn01_00093673 predicted 1067
6 SASI_Rn01_00093675 predicted 823
7 SASI_Rn01_00093676 predicted 943
8 SASI_Rn01_00093677 predicted 1332
9 SASI_Rn01_00093678 predicted 748
10 SASI_Rn02_00264478 predicted 1516
11 SASI_Rn01_00093672 predicted 554
12 SASI_Rn01_00093674 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105241 predicted 1458
2 SASI_Mm01_00105242 predicted 1068
3 SASI_Mm01_00105243 predicted 339
4 SASI_Mm01_00105244 predicted 880
5 SASI_Mm01_00105246 predicted 246
6 SASI_Mm01_00105248 predicted 427
7 SASI_Mm01_00105249 predicted 1405
8 SASI_Mm01_00105250 predicted 260
9 SASI_Mm02_00319781 predicted 1519
10 SASI_Mm02_00319782 predicted 747
11 SASI_Mm01_00105245 predicted 1614
12 SASI_Mm01_00105247 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011040
PAX8 MISSION shRNA Bacterial Glycerol Stock
paired box 8
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011040.3-1608s21c1
Sequence:CCGGAGTCACACAAAGGAATCTTTACTCGAGTAAAGATTCCTTTGTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011040.2-2341s1c1
Sequence:CCGGCCTCACTGTAAATACCGTAAACTCGAGTTTACGGTATTTACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1454s1c1
Sequence:CCGGGCCTGCTGAGTTCTCCATATTCTCGAGAATATGGAGAACTCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-738s1c1
Sequence:CCGGTGGCAATGACAACAAGAGAAACTCGAGTTTCTCTTGTTGTCATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-995s1c1
Sequence:CCGGCCACCCTGACATCTTCCAATACTCGAGTATTGGAAGATGTCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1455s1c1
Sequence:CCGGCCTGCTGAGTTCTCCATATTACTCGAGTAATATGGAGAACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011040
PAX8 MISSION shRNA shRNA Plasmid DNA
paired box 8
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011040.3-1608s21c1
Sequence:CCGGAGTCACACAAAGGAATCTTTACTCGAGTAAAGATTCCTTTGTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011040.2-2341s1c1
Sequence:CCGGCCTCACTGTAAATACCGTAAACTCGAGTTTACGGTATTTACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1454s1c1
Sequence:CCGGGCCTGCTGAGTTCTCCATATTCTCGAGAATATGGAGAACTCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-738s1c1
Sequence:CCGGTGGCAATGACAACAAGAGAAACTCGAGTTTCTCTTGTTGTCATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-995s1c1
Sequence:CCGGCCACCCTGACATCTTCCAATACTCGAGTATTGGAAGATGTCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1455s1c1
Sequence:CCGGCCTGCTGAGTTCTCCATATTACTCGAGTAATATGGAGAACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011040
PAX8 MISSION shRNA Lentiviral Transduction Particles
paired box 8
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011040.3-1608s21c1
Sequence:CCGGAGTCACACAAAGGAATCTTTACTCGAGTAAAGATTCCTTTGTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011040.2-2341s1c1
Sequence:CCGGCCTCACTGTAAATACCGTAAACTCGAGTTTACGGTATTTACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1454s1c1
Sequence:CCGGGCCTGCTGAGTTCTCCATATTCTCGAGAATATGGAGAACTCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-738s1c1
Sequence:CCGGTGGCAATGACAACAAGAGAAACTCGAGTTTCTCTTGTTGTCATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-995s1c1
Sequence:CCGGCCACCCTGACATCTTCCAATACTCGAGTATTGGAAGATGTCAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011040.2-1455s1c1
Sequence:CCGGCCTGCTGAGTTCTCCATATTACTCGAGTAATATGGAGAACTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003466
PAX8 MISSION shRNA Bacterial Glycerol Stock
paired box 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1645s21c1
Sequence:CCGGACACTCCCTGTGTGGTTAATTCTCGAGAATTAACCACACAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-772s21c1
Sequence:CCGGTCAGGATAGCTGCCGACTAAGCTCGAGCTTAGTCGGCAGCTATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1917s21c1
Sequence:CCGGTTAACACAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-1070s21c1
Sequence:CCGGCACTCACCCTTCGCCATAAAGCTCGAGCTTTATGGCGAAGGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-1132s1c1
Sequence:CCGGCTCTTTATCTAGCTCCGCCTTCTCGAGAAGGCGGAGCTAGATAAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-577s1c1
Sequence:CCGGGCAACCATTCAACCTCCCTATCTCGAGATAGGGAGGTTGAATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-784s1c1
Sequence:CCGGCCGACTAAGCATTGACTCACACTCGAGTGTGAGTCAATGCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-533s1c1
Sequence:CCGGCCCAGTGTCAGCTCCATTAATCTCGAGATTAATGGAGCTGACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003466
PAX8 MISSION shRNA shRNA Plasmid DNA
paired box 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1645s21c1
Sequence:CCGGACACTCCCTGTGTGGTTAATTCTCGAGAATTAACCACACAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-772s21c1
Sequence:CCGGTCAGGATAGCTGCCGACTAAGCTCGAGCTTAGTCGGCAGCTATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1917s21c1
Sequence:CCGGTTAACACAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-1070s21c1
Sequence:CCGGCACTCACCCTTCGCCATAAAGCTCGAGCTTTATGGCGAAGGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-1132s1c1
Sequence:CCGGCTCTTTATCTAGCTCCGCCTTCTCGAGAAGGCGGAGCTAGATAAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-577s1c1
Sequence:CCGGGCAACCATTCAACCTCCCTATCTCGAGATAGGGAGGTTGAATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-784s1c1
Sequence:CCGGCCGACTAAGCATTGACTCACACTCGAGTGTGAGTCAATGCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-533s1c1
Sequence:CCGGCCCAGTGTCAGCTCCATTAATCTCGAGATTAATGGAGCTGACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003466
PAX8 MISSION shRNA Lentiviral Transduction Particles
paired box 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1645s21c1
Sequence:CCGGACACTCCCTGTGTGGTTAATTCTCGAGAATTAACCACACAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-772s21c1
Sequence:CCGGTCAGGATAGCTGCCGACTAAGCTCGAGCTTAGTCGGCAGCTATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003466.3-1917s21c1
Sequence:CCGGTTAACACAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003466.3-1070s21c1
Sequence:CCGGCACTCACCCTTCGCCATAAAGCTCGAGCTTTATGGCGAAGGGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-1132s1c1
Sequence:CCGGCTCTTTATCTAGCTCCGCCTTCTCGAGAAGGCGGAGCTAGATAAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-577s1c1
Sequence:CCGGGCAACCATTCAACCTCCCTATCTCGAGATAGGGAGGTTGAATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-784s1c1
Sequence:CCGGCCGACTAAGCATTGACTCACACTCGAGTGTGAGTCAATGCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003466.2-533s1c1
Sequence:CCGGCCCAGTGTCAGCTCCATTAATCTCGAGATTAATGGAGCTGACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks