EMAIL THIS PAGE TO A FRIEND

PBK

PDZ binding kinase

Synonyms: CT84 Nori-3 SPK TOPK
UniProtKB ID: Q96KB5, D3DST2, Q9NPD9, Q9NYL7, Q9NZK6
Gene ID:
Human(55872) Summary: This genes encodes a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family. Evidence suggests that mitotic phosphorylation is required for its catalytic activity. This mitotic kinase may be involved in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(52033) PDZ binding kinase
Rat(290326) PDZ binding kinase
Zebrafish(360218) PDZ binding kinase
domestic cat(101080784) PDZ binding kinase
cow(534781) PDZ binding kinase
dog(477371) PDZ binding kinase
chicken(422003) PDZ binding kinase
sheep(101114676) PDZ binding kinase
domestic guinea pig(100735332) PDZ binding kinase
naked mole-rat(101720410) PDZ binding kinase
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407709 Anti-PBK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412112 ANTI-PBK antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412132 ANTI-PBK antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412198 ANTI-PBK antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412245 ANTI-PBK antibody produced in mouse clone 3A7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412269 ANTI-PBK antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412270 ANTI-PBK antibody produced in mouse clone 2A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412271 ANTI-PBK antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412452 ANTI-PBK antibody produced in mouse clone 4E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV48842 Anti-PBK antibody produced in rabbit affinity isolated antibody bovine, zebrafish, pig, human, rat, guinea pig, rabbit, canine, mouse, horse
western blot pricing
HPA005753 Anti-PBK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA050656 Anti-PBK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
SAB4502373 Anti-PBK, N-Terminal antibody produced in rabbit affinity isolated antibody human
pricing
SAB4504053 Anti-phospho-PBK/TOPK (pThr9) antibody produced in rabbit affinity isolated antibody human, mouse, rat
pricing
WH0055872M6 Monoclonal Anti-PBK antibody produced in mouse clone 4A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300406 Monoclonal Anti-PBK antibody produced in mouse clone 2C8, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405168 Monoclonal Anti-PBK, (N-terminal) antibody produced in mouse clone 3A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050111 MISSION® esiRNA esiRNA human PBK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018492 siRNAs that have been validated in the lab human pricing
NM_001079937 Rosetta Predictions rat pricing
NM_023209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018492 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225166 validated 1272
1 SASI_Hs01_00225167 validated 397
1 SASI_Hs01_00225165 validated 375
2 SASI_Hs01_00225168 predicted 1262
3 SASI_Hs01_00225169 predicted 568
4 SASI_Hs02_00352088 predicted 569
5 SASI_Hs01_00225171 predicted 436
6 SASI_Hs01_00225172 predicted 482
7 SASI_Hs02_00352089 predicted 695
8 SASI_Hs02_00352090 predicted 1259
9 SASI_Hs01_00225173 predicted 1342
10 SASI_Hs01_00225174 predicted 1225
11 SASI_Hs01_00225170 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208319 predicted 1320
2 SASI_Rn02_00208320 predicted 1333
3 SASI_Rn02_00208321 predicted 1328
4 SASI_Rn02_00208322 predicted 1298
5 SASI_Rn02_00208323 predicted 512
6 SASI_Rn02_00208324 predicted 1322
7 SASI_Rn02_00208325 predicted 1288
8 SASI_Rn02_00208326 predicted 1291
9 SASI_Rn02_00208327 predicted 484
10 SASI_Rn02_00208328 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057215 predicted 1140
2 SASI_Mm01_00057207 predicted 1284
3 SASI_Mm01_00057216 predicted 1029
4 SASI_Mm01_00057208 predicted 1217
5 SASI_Mm02_00326951 predicted 1181
6 SASI_Mm02_00326952 predicted 473
7 SASI_Mm02_00326953 predicted 951
8 SASI_Mm02_00326954 predicted 735
9 SASI_Mm01_00057211 predicted 1279
10 SASI_Mm01_00057213 predicted 1244
11 SASI_Mm01_00057209 predicted 1183
12 SASI_Mm01_00057210 predicted 1182
13 SASI_Mm01_00057212 predicted 1266
14 SASI_Mm01_00057214 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018492
VALIDATED
PBK MISSION shRNA Bacterial Glycerol Stock
PDZ binding kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-410s1c1
Sequence:CCGGGTAATGATCATTATCGAAGTGCTCGAGCACTTCGATAATGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-473s1c1
Sequence:CCGGGCCTTCATCATCCAAACATTGCTCGAGCAATGTTTGGATGATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-933s1c1
Sequence:CCGGGATTCCACACATTAATCTTTCCTCGAGGAAAGATTAATGTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-1087s1c1
Sequence:CCGGCTCTTCTCTGTATGCACTAATCTCGAGATTAGTGCATACAGAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-227s1c1
Sequence:CCGGCACCAAGCAAATTATCAGAAACTCGAGTTTCTGATAATTTGCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-645s1c1
Sequence:CCGGGAATATGGCAAGAGGGTTAAACTCGAGTTTAACCCTCTTGCCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1026s1c1
Sequence:CCGGGGGAACTAGGCCACCTATTAACTCGAGTTAATAGGTGGCCTAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1185s1c1
Sequence:CCGGGAAGTGTGGCTTGCGTAAATACTCGAGTATTTACGCAAGCCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018492
VALIDATED
PBK MISSION shRNA shRNA Plasmid DNA
PDZ binding kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-410s1c1
Sequence:CCGGGTAATGATCATTATCGAAGTGCTCGAGCACTTCGATAATGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-473s1c1
Sequence:CCGGGCCTTCATCATCCAAACATTGCTCGAGCAATGTTTGGATGATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-933s1c1
Sequence:CCGGGATTCCACACATTAATCTTTCCTCGAGGAAAGATTAATGTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-1087s1c1
Sequence:CCGGCTCTTCTCTGTATGCACTAATCTCGAGATTAGTGCATACAGAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-227s1c1
Sequence:CCGGCACCAAGCAAATTATCAGAAACTCGAGTTTCTGATAATTTGCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-645s1c1
Sequence:CCGGGAATATGGCAAGAGGGTTAAACTCGAGTTTAACCCTCTTGCCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1026s1c1
Sequence:CCGGGGGAACTAGGCCACCTATTAACTCGAGTTAATAGGTGGCCTAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1185s1c1
Sequence:CCGGGAAGTGTGGCTTGCGTAAATACTCGAGTATTTACGCAAGCCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018492
VALIDATED
PBK MISSION shRNA Lentiviral Transduction Particles
PDZ binding kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-410s1c1
Sequence:CCGGGTAATGATCATTATCGAAGTGCTCGAGCACTTCGATAATGATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-473s1c1
Sequence:CCGGGCCTTCATCATCCAAACATTGCTCGAGCAATGTTTGGATGATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-933s1c1
Sequence:CCGGGATTCCACACATTAATCTTTCCTCGAGGAAAGATTAATGTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-1087s1c1
Sequence:CCGGCTCTTCTCTGTATGCACTAATCTCGAGATTAGTGCATACAGAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-227s1c1
Sequence:CCGGCACCAAGCAAATTATCAGAAACTCGAGTTTCTGATAATTTGCTTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018492.x-645s1c1
Sequence:CCGGGAATATGGCAAGAGGGTTAAACTCGAGTTTAACCCTCTTGCCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1026s1c1
Sequence:CCGGGGGAACTAGGCCACCTATTAACTCGAGTTAATAGGTGGCCTAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018492.2-1185s1c1
Sequence:CCGGGAAGTGTGGCTTGCGTAAATACTCGAGTATTTACGCAAGCCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023209
VALIDATED
PBK MISSION shRNA Bacterial Glycerol Stock
PDZ binding kinase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-374s1c1
Sequence:CCGGGTCAGCGTTTACCTAATGAAACTCGAGTTTCATTAGGTAAACGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-483s1c1
Sequence:CCGGAGAGACTAACTGATGAAGCTACTCGAGTAGCTTCATCAGTTAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-946s1c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-980s1c1
Sequence:CCGGCCACACGTCAATCTTCCAGATCTCGAGATCTGGAAGATTGACGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-584s1c1
Sequence:CCGGGCTATGGAGTATGGAGGTGAACTCGAGTTCACCTCCATACTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023209.2-1420s21c1
Sequence:CCGGACGTACATGTGGTACAGATATCTCGAGATATCTGTACCACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-849s21c1
Sequence:CCGGAGGCCTGTTATATTGGTACTGCTCGAGCAGTACCAATATAACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1204s21c1
Sequence:CCGGTGGCCAATGTTGTGGTCTAAGCTCGAGCTTAGACCACAACATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1291s21c1
Sequence:CCGGTAGATTCTAGAAGTAGCTTTACTCGAGTAAAGCTACTTCTAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1128s21c1
Sequence:CCGGTCTTCTGTGTGTGCACTAATGCTCGAGCATTAGTGCACACACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-943s21c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1171s21c1
Sequence:CCGGTGCTGCACACATCGTTGAAGCCTCGAGGCTTCAACGATGTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023209
VALIDATED
PBK MISSION shRNA shRNA Plasmid DNA
PDZ binding kinase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-374s1c1
Sequence:CCGGGTCAGCGTTTACCTAATGAAACTCGAGTTTCATTAGGTAAACGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-483s1c1
Sequence:CCGGAGAGACTAACTGATGAAGCTACTCGAGTAGCTTCATCAGTTAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-946s1c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-980s1c1
Sequence:CCGGCCACACGTCAATCTTCCAGATCTCGAGATCTGGAAGATTGACGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-584s1c1
Sequence:CCGGGCTATGGAGTATGGAGGTGAACTCGAGTTCACCTCCATACTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023209.2-1420s21c1
Sequence:CCGGACGTACATGTGGTACAGATATCTCGAGATATCTGTACCACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-849s21c1
Sequence:CCGGAGGCCTGTTATATTGGTACTGCTCGAGCAGTACCAATATAACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1204s21c1
Sequence:CCGGTGGCCAATGTTGTGGTCTAAGCTCGAGCTTAGACCACAACATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1291s21c1
Sequence:CCGGTAGATTCTAGAAGTAGCTTTACTCGAGTAAAGCTACTTCTAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1128s21c1
Sequence:CCGGTCTTCTGTGTGTGCACTAATGCTCGAGCATTAGTGCACACACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-943s21c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1171s21c1
Sequence:CCGGTGCTGCACACATCGTTGAAGCCTCGAGGCTTCAACGATGTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023209
VALIDATED
PBK MISSION shRNA Lentiviral Transduction Particles
PDZ binding kinase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-374s1c1
Sequence:CCGGGTCAGCGTTTACCTAATGAAACTCGAGTTTCATTAGGTAAACGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-483s1c1
Sequence:CCGGAGAGACTAACTGATGAAGCTACTCGAGTAGCTTCATCAGTTAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023209.1-946s1c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-980s1c1
Sequence:CCGGCCACACGTCAATCTTCCAGATCTCGAGATCTGGAAGATTGACGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023209.1-584s1c1
Sequence:CCGGGCTATGGAGTATGGAGGTGAACTCGAGTTCACCTCCATACTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023209.2-1420s21c1
Sequence:CCGGACGTACATGTGGTACAGATATCTCGAGATATCTGTACCACATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-849s21c1
Sequence:CCGGAGGCCTGTTATATTGGTACTGCTCGAGCAGTACCAATATAACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1204s21c1
Sequence:CCGGTGGCCAATGTTGTGGTCTAAGCTCGAGCTTAGACCACAACATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1291s21c1
Sequence:CCGGTAGATTCTAGAAGTAGCTTTACTCGAGTAAAGCTACTTCTAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-1128s21c1
Sequence:CCGGTCTTCTGTGTGTGCACTAATGCTCGAGCATTAGTGCACACACAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023209.2-943s21c1
Sequence:CCGGCCTTACTCTGTGGGAAATGATCTCGAGATCATTTCCCACAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023209.2-1171s21c1
Sequence:CCGGTGCTGCACACATCGTTGAAGCCTCGAGGCTTCAACGATGTGTGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks