EMAIL THIS PAGE TO A FRIEND

PCBD2

pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2

Synonyms: DCOH2 DCOHM PHS2
UniProtKB ID: Q9H0N5, Q8TD40
Gene ID:
Mouse(72562) pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Rat(685729) pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
naked mole-rat(101709065) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
domestic guinea pig(100730652) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
cow(100297795) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
sheep(101119306) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
chicken(374030) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
dog(609970) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
domestic cat(101086943) pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Gene Class: Dehydratase
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032151 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003911 MISSION® esiRNA esiRNA targeting mouse Pcbd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032151 Rosetta Predictions human pricing
XM_001065028 Rosetta Predictions rat pricing
NM_028281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359386 predicted 267
2 SASI_Hs01_00037989 predicted 254
3 SASI_Hs01_00037990 predicted 240
4 SASI_Hs01_00037991 predicted 202
5 SASI_Hs01_00037992 predicted 253
6 SASI_Hs01_00037993 predicted 204
7 SASI_Hs01_00037995 predicted 241
8 SASI_Hs01_00037996 predicted 255
9 SASI_Hs01_00037997 predicted 245
10 SASI_Hs01_00037998 predicted 263
11 SASI_Hs01_00037994 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312610 predicted 679
2 SASI_Rn02_00312611 predicted 395
3 SASI_Rn02_00312612 predicted 410
4 SASI_Rn02_00312613 predicted 159
5 SASI_Rn02_00312614 predicted 310
6 SASI_Rn02_00312615 predicted 710
7 SASI_Rn02_00312616 predicted 717
8 SASI_Rn02_00312617 predicted 552
9 SASI_Rn02_00312618 predicted 675
10 SASI_Rn02_00312619 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172222 predicted 236
2 SASI_Mm01_00172223 predicted 200
3 SASI_Mm01_00172224 predicted 230
4 SASI_Mm01_00172225 predicted 283
5 SASI_Mm01_00172226 predicted 276
6 SASI_Mm01_00172227 predicted 290
7 SASI_Mm01_00172228 predicted 266
8 SASI_Mm01_00172229 predicted 285
9 SASI_Mm01_00172230 predicted 303
10 SASI_Mm01_00172231 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028281
VALIDATED
PCBD2 MISSION shRNA Bacterial Glycerol Stock
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-146s21c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-293s21c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-308s21c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028281.1-422s21c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-107s21c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-107s1c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-293s1c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-146s1c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-422s1c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-308s1c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028281
VALIDATED
PCBD2 MISSION shRNA shRNA Plasmid DNA
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-146s21c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-293s21c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-308s21c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028281.1-422s21c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-107s21c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-107s1c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-293s1c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-146s1c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-422s1c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-308s1c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028281
VALIDATED
PCBD2 MISSION shRNA Lentiviral Transduction Particles
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-146s21c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-293s21c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-308s21c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028281.1-422s21c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028281.1-107s21c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-107s1c1
Sequence:CCGGGTCTTCAGATGCACAGTGGTTCTCGAGAACCACTGTGCATCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-293s1c1
Sequence:CCGGCCCGGAATGGTTCAACGTCTACTCGAGTAGACGTTGAACCATTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-146s1c1
Sequence:CCGGCCAACTTATTCCTGGCTTGAACTCGAGTTCAAGCCAGGAATAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-422s1c1
Sequence:CCGGGCCTGCCTTGTCTGCAGCGTTCTCGAGAACGCTGCAGACAAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028281.1-308s1c1
Sequence:CCGGCGTCTACAACAAAGTCCAGATCTCGAGATCTGGACTTTGTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032151
PCBD2 MISSION shRNA Bacterial Glycerol Stock
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-153s1c1
Sequence:CCGGCTTGACCTTAAAGCAGCAGGACTCGAGTCCTGCTGCTTTAAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-273s1c1
Sequence:CCGGGAGAAGATGAATCATCACCCACTCGAGTGGGTGATGATTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-267s1c1
Sequence:CCGGCAAGCAGAGAAGATGAATCATCTCGAGATGATTCATCTTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-144s1c1
Sequence:CCGGCAAGCTATACTTGACCTTAAACTCGAGTTTAAGGTCAAGTATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-143s1c1
Sequence:CCGGCCAAGCTATACTTGACCTTAACTCGAGTTAAGGTCAAGTATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-135s1c1
Sequence:CCGGGAGAGGAACCAAGCTATACTTCTCGAGAAGTATAGCTTGGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-122s1c1
Sequence:CCGGGTTGATTGCAGAGGAGAGGAACTCGAGTTCCTCTCCTCTGCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-237s1c1
Sequence:CCGGGCATTTGGCTTTATGTCCCGACTCGAGTCGGGACATAAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-172s1c1
Sequence:CCGGGATGGTCGGAATTAAGTGAGACTCGAGTCTCACTTAATTCCGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-278s1c1
Sequence:CCGGGATGAATCATCACCCAGAATGCTCGAGCATTCTGGGTGATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-168s1c1
Sequence:CCGGGCAGGATGGTCGGAATTAAGTCTCGAGACTTAATTCCGACCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032151
PCBD2 MISSION shRNA shRNA Plasmid DNA
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-153s1c1
Sequence:CCGGCTTGACCTTAAAGCAGCAGGACTCGAGTCCTGCTGCTTTAAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-273s1c1
Sequence:CCGGGAGAAGATGAATCATCACCCACTCGAGTGGGTGATGATTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-267s1c1
Sequence:CCGGCAAGCAGAGAAGATGAATCATCTCGAGATGATTCATCTTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-144s1c1
Sequence:CCGGCAAGCTATACTTGACCTTAAACTCGAGTTTAAGGTCAAGTATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-143s1c1
Sequence:CCGGCCAAGCTATACTTGACCTTAACTCGAGTTAAGGTCAAGTATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-135s1c1
Sequence:CCGGGAGAGGAACCAAGCTATACTTCTCGAGAAGTATAGCTTGGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-122s1c1
Sequence:CCGGGTTGATTGCAGAGGAGAGGAACTCGAGTTCCTCTCCTCTGCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-237s1c1
Sequence:CCGGGCATTTGGCTTTATGTCCCGACTCGAGTCGGGACATAAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-172s1c1
Sequence:CCGGGATGGTCGGAATTAAGTGAGACTCGAGTCTCACTTAATTCCGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-278s1c1
Sequence:CCGGGATGAATCATCACCCAGAATGCTCGAGCATTCTGGGTGATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-168s1c1
Sequence:CCGGGCAGGATGGTCGGAATTAAGTCTCGAGACTTAATTCCGACCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032151
PCBD2 MISSION shRNA Lentiviral Transduction Particles
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-153s1c1
Sequence:CCGGCTTGACCTTAAAGCAGCAGGACTCGAGTCCTGCTGCTTTAAGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-273s1c1
Sequence:CCGGGAGAAGATGAATCATCACCCACTCGAGTGGGTGATGATTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-267s1c1
Sequence:CCGGCAAGCAGAGAAGATGAATCATCTCGAGATGATTCATCTTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-144s1c1
Sequence:CCGGCAAGCTATACTTGACCTTAAACTCGAGTTTAAGGTCAAGTATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-143s1c1
Sequence:CCGGCCAAGCTATACTTGACCTTAACTCGAGTTAAGGTCAAGTATAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-135s1c1
Sequence:CCGGGAGAGGAACCAAGCTATACTTCTCGAGAAGTATAGCTTGGTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-122s1c1
Sequence:CCGGGTTGATTGCAGAGGAGAGGAACTCGAGTTCCTCTCCTCTGCAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-237s1c1
Sequence:CCGGGCATTTGGCTTTATGTCCCGACTCGAGTCGGGACATAAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-172s1c1
Sequence:CCGGGATGGTCGGAATTAAGTGAGACTCGAGTCTCACTTAATTCCGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-278s1c1
Sequence:CCGGGATGAATCATCACCCAGAATGCTCGAGCATTCTGGGTGATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032151.2-168s1c1
Sequence:CCGGGCAGGATGGTCGGAATTAAGTCTCGAGACTTAATTCCGACCATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks