EMAIL THIS PAGE TO A FRIEND

PCDHB16

protocadherin beta 16

Synonyms: ME1 PCDH-BETA16 PCDH3X PCDHB8a
UniProtKB ID: Q9NRJ7, B3KPK5, Q8IYD5, Q96SE9, Q9HCF1
Gene ID:
Human(57717) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93887) protocadherin beta 16
Rat(291645) protocadherin beta 16
cow(100848138) protocadherin beta 16
sheep(101123632) protocadherin beta 16
Horse(100072301) protocadherin beta 16
domestic cat(101080953) protocadherin beta 16
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020957 Rosetta Predictions human pricing
XM_001065196 Rosetta Predictions rat pricing
XM_574129 Rosetta Predictions rat pricing
NM_053141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051098 predicted 1947
2 SASI_Hs01_00051099 predicted 3540
3 SASI_Hs01_00051100 predicted 1992
4 SASI_Hs01_00051101 predicted 3579
5 SASI_Hs01_00051102 predicted 3566
6 SASI_Hs02_00354383 predicted 1503
7 SASI_Hs01_00051104 predicted 1370
8 SASI_Hs01_00051105 predicted 1674
9 SASI_Hs01_00051106 predicted 2092
10 SASI_Hs01_00051107 predicted 1769
11 SASI_Hs01_00051103 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313221 predicted 1036
2 SASI_Rn02_00313222 predicted 340
3 SASI_Rn02_00313223 predicted 727
4 SASI_Rn02_00313224 predicted 911
5 SASI_Rn02_00313225 predicted 1008
6 SASI_Rn02_00313226 predicted 1268
7 SASI_Rn02_00313227 predicted 2269
8 SASI_Rn02_00313228 predicted 615
9 SASI_Rn02_00313229 predicted 752
10 SASI_Rn02_00313230 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401431 predicted 1039
2 SASI_Rn02_00401432 predicted 335
3 SASI_Rn02_00401433 predicted 728
4 SASI_Rn02_00401434 predicted 916
5 SASI_Rn02_00401435 predicted 1007
6 SASI_Rn02_00401436 predicted 1266
7 SASI_Rn02_00401437 predicted 2272
8 SASI_Rn02_00401438 predicted 622
9 SASI_Rn02_00401439 predicted 746
10 SASI_Rn02_00401440 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047073 predicted 1162
2 SASI_Mm01_00047075 predicted 2079
3 SASI_Mm02_00337664 predicted 666
4 SASI_Mm01_00047076 predicted 341
5 SASI_Mm01_00047077 predicted 1046
6 SASI_Mm01_00047078 predicted 1305
7 SASI_Mm01_00047079 predicted 1019
8 SASI_Mm02_00337665 predicted 988
9 SASI_Mm01_00047080 predicted 274
10 SASI_Mm01_00047081 predicted 1160
11 SASI_Mm01_00047074 predicted 351
12 SASI_Mm01_00047082 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053141
PCDHB16 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053141.2-3636s1c1
Sequence:CCGGCGGGCTAAAGTAGCATGAAATCTCGAGATTTCATGCTACTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-1158s1c1
Sequence:CCGGGCCCAAGTCTTGGATGTGAATCTCGAGATTCACATCCAAGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-650s1c1
Sequence:CCGGCGGTATTGACAAGTATCTGATCTCGAGATCAGATACTTGTCAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-515s1c1
Sequence:CCGGGCTAGAAGTCACAGACATAAACTCGAGTTTATGTCTGTGACTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-2010s1c1
Sequence:CCGGGCACACAATGGAGAGGTACATCTCGAGATGTACCTCTCCATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053141
PCDHB16 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053141.2-3636s1c1
Sequence:CCGGCGGGCTAAAGTAGCATGAAATCTCGAGATTTCATGCTACTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-1158s1c1
Sequence:CCGGGCCCAAGTCTTGGATGTGAATCTCGAGATTCACATCCAAGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-650s1c1
Sequence:CCGGCGGTATTGACAAGTATCTGATCTCGAGATCAGATACTTGTCAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-515s1c1
Sequence:CCGGGCTAGAAGTCACAGACATAAACTCGAGTTTATGTCTGTGACTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-2010s1c1
Sequence:CCGGGCACACAATGGAGAGGTACATCTCGAGATGTACCTCTCCATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053141
PCDHB16 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053141.2-3636s1c1
Sequence:CCGGCGGGCTAAAGTAGCATGAAATCTCGAGATTTCATGCTACTTTAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-1158s1c1
Sequence:CCGGGCCCAAGTCTTGGATGTGAATCTCGAGATTCACATCCAAGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-650s1c1
Sequence:CCGGCGGTATTGACAAGTATCTGATCTCGAGATCAGATACTTGTCAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-515s1c1
Sequence:CCGGGCTAGAAGTCACAGACATAAACTCGAGTTTATGTCTGTGACTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053141.2-2010s1c1
Sequence:CCGGGCACACAATGGAGAGGTACATCTCGAGATGTACCTCTCCATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020957
PCDHB16 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1888s1c1
Sequence:CCGGCCCATCTACAAAGTGCAGATTCTCGAGAATCTGCACTTTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1456s1c1
Sequence:CCGGCCTTGCATACTACATTTCCAACTCGAGTTGGAAATGTAGTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-2457s1c1
Sequence:CCGGGCACAACATAACAGTGCAGATCTCGAGATCTGCACTGTTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1679s1c1
Sequence:CCGGGCTCTCATTTCCGGGTTCTAACTCGAGTTAGAACCCGGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1250s1c1
Sequence:CCGGCCTATTCCGTAGTGGAAGAAACTCGAGTTTCTTCCACTACGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3871s21c1
Sequence:CCGGTTGCATGTATTAGGCATATTTCTCGAGAAATATGCCTAATACATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3616s21c1
Sequence:CCGGACCACCACCAATAAGGTATTTCTCGAGAAATACCTTATTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3698s21c1
Sequence:CCGGCCCGAAGAGGTGTTGCATATACTCGAGTATATGCAACACCTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020957
PCDHB16 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1888s1c1
Sequence:CCGGCCCATCTACAAAGTGCAGATTCTCGAGAATCTGCACTTTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1456s1c1
Sequence:CCGGCCTTGCATACTACATTTCCAACTCGAGTTGGAAATGTAGTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-2457s1c1
Sequence:CCGGGCACAACATAACAGTGCAGATCTCGAGATCTGCACTGTTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1679s1c1
Sequence:CCGGGCTCTCATTTCCGGGTTCTAACTCGAGTTAGAACCCGGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1250s1c1
Sequence:CCGGCCTATTCCGTAGTGGAAGAAACTCGAGTTTCTTCCACTACGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3871s21c1
Sequence:CCGGTTGCATGTATTAGGCATATTTCTCGAGAAATATGCCTAATACATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3616s21c1
Sequence:CCGGACCACCACCAATAAGGTATTTCTCGAGAAATACCTTATTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3698s21c1
Sequence:CCGGCCCGAAGAGGTGTTGCATATACTCGAGTATATGCAACACCTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020957
PCDHB16 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1888s1c1
Sequence:CCGGCCCATCTACAAAGTGCAGATTCTCGAGAATCTGCACTTTGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1456s1c1
Sequence:CCGGCCTTGCATACTACATTTCCAACTCGAGTTGGAAATGTAGTATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-2457s1c1
Sequence:CCGGGCACAACATAACAGTGCAGATCTCGAGATCTGCACTGTTATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1679s1c1
Sequence:CCGGGCTCTCATTTCCGGGTTCTAACTCGAGTTAGAACCCGGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020957.1-1250s1c1
Sequence:CCGGCCTATTCCGTAGTGGAAGAAACTCGAGTTTCTTCCACTACGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3871s21c1
Sequence:CCGGTTGCATGTATTAGGCATATTTCTCGAGAAATATGCCTAATACATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3616s21c1
Sequence:CCGGACCACCACCAATAAGGTATTTCTCGAGAAATACCTTATTGGTGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020957.1-3698s21c1
Sequence:CCGGCCCGAAGAGGTGTTGCATATACTCGAGTATATGCAACACCTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks