EMAIL THIS PAGE TO A FRIEND

PCDHB18

protocadherin beta 18 pseudogene

Synonyms: PCDH-psi2
UniProtKB ID: Q96TA0, B3KTF8
Gene ID:
Mouse(93889) protocadherin beta 18
Rat(548105) protocadherin beta 18
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080501 MISSION® esiRNA esiRNA targeting mouse Pcdhb18 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_001281 Rosetta Predictions human pricing
XM_001055991 Rosetta Predictions rat pricing
XM_001065313 Rosetta Predictions rat pricing
NM_053143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_001281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374601 predicted 380
2 SASI_Hs02_00374602 predicted 920
3 SASI_Hs02_00374603 predicted 719
4 SASI_Hs02_00374604 predicted 381
5 SASI_Hs02_00374605 predicted 2580
6 SASI_Hs02_00374606 predicted 1320
7 SASI_Hs02_00374607 predicted 800
8 SASI_Hs02_00374608 predicted 415
9 SASI_Hs02_00374609 predicted 631
10 SASI_Hs02_00374610 predicted 2688
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281690 predicted 972
2 SASI_Rn02_00281691 predicted 1085
3 SASI_Rn02_00281692 predicted 273
4 SASI_Rn02_00281693 predicted 826
5 SASI_Rn02_00281694 predicted 1094
6 SASI_Rn02_00281695 predicted 769
7 SASI_Rn02_00281696 predicted 535
8 SASI_Rn02_00281697 predicted 230
9 SASI_Rn02_00281698 predicted 1227
10 SASI_Rn02_00281699 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313701 predicted 977
2 SASI_Rn02_00313702 predicted 1091
3 SASI_Rn02_00313703 predicted 284
4 SASI_Rn02_00313704 predicted 836
5 SASI_Rn02_00313705 predicted 1092
6 SASI_Rn02_00313706 predicted 773
7 SASI_Rn02_00313707 predicted 541
8 SASI_Rn02_00313708 predicted 236
9 SASI_Rn02_00313709 predicted 1233
10 SASI_Rn02_00313710 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071158 predicted 972
2 SASI_Mm01_00071159 predicted 1085
3 SASI_Mm01_00071160 predicted 774
4 SASI_Mm01_00071161 predicted 767
5 SASI_Mm01_00071162 predicted 1092
6 SASI_Mm01_00071164 predicted 1057
7 SASI_Mm01_00071165 predicted 915
8 SASI_Mm01_00071166 predicted 829
9 SASI_Mm01_00071167 predicted 1088
10 SASI_Mm02_00337667 predicted 2465
11 SASI_Mm01_00071163 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053143
PCDHB18 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 18 pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-677s1c1
Sequence:CCGGCCACTATACATATTCTGGTTTCTCGAGAAACCAGAATATGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-1530s1c1
Sequence:CCGGCGGGCAACTGTTTGCAATCAACTCGAGTTGATTGCAAACAGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-240s1c1
Sequence:CCGGCACTGGAGATTTGCTCACAAACTCGAGTTTGTGAGCAAATCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-865s1c1
Sequence:CCGGCGAGCAACCTTTCAAATCAATCTCGAGATTGATTTGAAAGGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-918s1c1
Sequence:CCGGGCTTGACTATGAGTTCATAAACTCGAGTTTATGAACTCATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053143
PCDHB18 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 18 pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-677s1c1
Sequence:CCGGCCACTATACATATTCTGGTTTCTCGAGAAACCAGAATATGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-1530s1c1
Sequence:CCGGCGGGCAACTGTTTGCAATCAACTCGAGTTGATTGCAAACAGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-240s1c1
Sequence:CCGGCACTGGAGATTTGCTCACAAACTCGAGTTTGTGAGCAAATCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-865s1c1
Sequence:CCGGCGAGCAACCTTTCAAATCAATCTCGAGATTGATTTGAAAGGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-918s1c1
Sequence:CCGGGCTTGACTATGAGTTCATAAACTCGAGTTTATGAACTCATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053143
PCDHB18 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 18 pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-677s1c1
Sequence:CCGGCCACTATACATATTCTGGTTTCTCGAGAAACCAGAATATGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-1530s1c1
Sequence:CCGGCGGGCAACTGTTTGCAATCAACTCGAGTTGATTGCAAACAGTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-240s1c1
Sequence:CCGGCACTGGAGATTTGCTCACAAACTCGAGTTTGTGAGCAAATCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-865s1c1
Sequence:CCGGCGAGCAACCTTTCAAATCAATCTCGAGATTGATTTGAAAGGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053143.1-918s1c1
Sequence:CCGGGCTTGACTATGAGTTCATAAACTCGAGTTTATGAACTCATAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks