EMAIL THIS PAGE TO A FRIEND

PCDHB9

protocadherin beta 9

Synonyms: PCDH-BETA9 PCDH3H
UniProtKB ID: Q9Y5E1, Q2M2U8, Q496X9, Q9NRJ8
Gene ID:
Human(56127) Summary: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Mouse(93880) protocadherin beta 9
Rat(680047) protocadherin beta 9
Domestic Rabbit(100350235) protocadherin beta 9
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019119 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019119 Rosetta Predictions human pricing
NM_001109390 Rosetta Predictions rat pricing
NM_053134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030501 predicted 681
2 SASI_Hs01_00030504 predicted 1001
3 SASI_Hs01_00030507 predicted 1176
4 SASI_Hs01_00030508 predicted 1132
5 SASI_Hs02_00352750 predicted 484
6 SASI_Hs02_00352751 predicted 390
7 SASI_Hs02_00352752 predicted 2459
8 SASI_Hs02_00352753 predicted 393
9 SASI_Hs02_00352754 predicted 391
10 SASI_Hs01_00030499 predicted 822
11 SASI_Hs01_00030500 predicted 910
12 SASI_Hs01_00030502 predicted 868
13 SASI_Hs01_00030503 predicted 927
14 SASI_Hs01_00030505 predicted 553
15 SASI_Hs01_00030506 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247946 predicted 446
2 SASI_Rn02_00247947 predicted 1141
3 SASI_Rn02_00247948 predicted 2527
4 SASI_Rn02_00247949 predicted 2381
5 SASI_Rn02_00247950 predicted 2633
6 SASI_Rn02_00247951 predicted 886
7 SASI_Rn02_00247952 predicted 2666
8 SASI_Rn02_00247953 predicted 579
9 SASI_Rn02_00247954 predicted 2633
10 SASI_Rn02_00247955 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047925 predicted 2186
2 SASI_Mm01_00047926 predicted 2520
3 SASI_Mm01_00047927 predicted 2620
4 SASI_Mm01_00047929 predicted 1330
5 SASI_Mm01_00047930 predicted 1996
6 SASI_Mm01_00047931 predicted 608
7 SASI_Mm01_00047932 predicted 1061
8 SASI_Mm01_00047933 predicted 2589
9 SASI_Mm01_00047934 predicted 1063
10 SASI_Mm02_00337652 predicted 2569
11 SASI_Mm01_00047928 predicted 1375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053134
VALIDATED
PCDHB9 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1056s1c1
Sequence:CCGGGCATCAGATGAAATCCAACAACTCGAGTTGTTGGATTTCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1703s1c1
Sequence:CCGGCCTCTCTTCGTTAATCTCGATCTCGAGATCGAGATTAACGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-2706s1c1
Sequence:CCGGGCACGCTTAGTCTGCCATTATCTCGAGATAATGGCAGACTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-620s1c1
Sequence:CCGGGCTCTTGAGAATACCAGAGAACTCGAGTTCTCTGGTATTCTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-236s1c1
Sequence:CCGGCAGGCAAGTAATGGCATTTATCTCGAGATAAATGCCATTACTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2706s21c1
Sequence:CCGGCACGCTTAGTCTGCCATTATACTCGAGTATAATGGCAGACTAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1696s21c1
Sequence:CCGGACTGGCCCTCTCTTCGTTAATCTCGAGATTAACGAAGAGAGGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1069s21c1
Sequence:CCGGCCAACAAACATTCTCAATAAACTCGAGTTTATTGAGAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-227s21c1
Sequence:CCGGCACCTAAACAGGCAAGTAATGCTCGAGCATTACTTGCCTGTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2757s21c1
Sequence:CCGGTCAGTGTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2255s21c1
Sequence:CCGGGATGAGGACGTGCTTACATTGCTCGAGCAATGTAAGCACGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2191s21c1
Sequence:CCGGAGTGGATGGCTTCTCACAATCCTCGAGGATTGTGAGAAGCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053134
VALIDATED
PCDHB9 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1056s1c1
Sequence:CCGGGCATCAGATGAAATCCAACAACTCGAGTTGTTGGATTTCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1703s1c1
Sequence:CCGGCCTCTCTTCGTTAATCTCGATCTCGAGATCGAGATTAACGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-2706s1c1
Sequence:CCGGGCACGCTTAGTCTGCCATTATCTCGAGATAATGGCAGACTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-620s1c1
Sequence:CCGGGCTCTTGAGAATACCAGAGAACTCGAGTTCTCTGGTATTCTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-236s1c1
Sequence:CCGGCAGGCAAGTAATGGCATTTATCTCGAGATAAATGCCATTACTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2706s21c1
Sequence:CCGGCACGCTTAGTCTGCCATTATACTCGAGTATAATGGCAGACTAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1696s21c1
Sequence:CCGGACTGGCCCTCTCTTCGTTAATCTCGAGATTAACGAAGAGAGGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1069s21c1
Sequence:CCGGCCAACAAACATTCTCAATAAACTCGAGTTTATTGAGAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-227s21c1
Sequence:CCGGCACCTAAACAGGCAAGTAATGCTCGAGCATTACTTGCCTGTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2757s21c1
Sequence:CCGGTCAGTGTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2255s21c1
Sequence:CCGGGATGAGGACGTGCTTACATTGCTCGAGCAATGTAAGCACGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2191s21c1
Sequence:CCGGAGTGGATGGCTTCTCACAATCCTCGAGGATTGTGAGAAGCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053134
VALIDATED
PCDHB9 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1056s1c1
Sequence:CCGGGCATCAGATGAAATCCAACAACTCGAGTTGTTGGATTTCATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-1703s1c1
Sequence:CCGGCCTCTCTTCGTTAATCTCGATCTCGAGATCGAGATTAACGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-2706s1c1
Sequence:CCGGGCACGCTTAGTCTGCCATTATCTCGAGATAATGGCAGACTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053134.2-620s1c1
Sequence:CCGGGCTCTTGAGAATACCAGAGAACTCGAGTTCTCTGGTATTCTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053134.2-236s1c1
Sequence:CCGGCAGGCAAGTAATGGCATTTATCTCGAGATAAATGCCATTACTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2706s21c1
Sequence:CCGGCACGCTTAGTCTGCCATTATACTCGAGTATAATGGCAGACTAAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1696s21c1
Sequence:CCGGACTGGCCCTCTCTTCGTTAATCTCGAGATTAACGAAGAGAGGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-1069s21c1
Sequence:CCGGCCAACAAACATTCTCAATAAACTCGAGTTTATTGAGAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-227s21c1
Sequence:CCGGCACCTAAACAGGCAAGTAATGCTCGAGCATTACTTGCCTGTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053134.3-2757s21c1
Sequence:CCGGTCAGTGTCTTTGGTGAATAATCTCGAGATTATTCACCAAAGACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2255s21c1
Sequence:CCGGGATGAGGACGTGCTTACATTGCTCGAGCAATGTAAGCACGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053134.3-2191s21c1
Sequence:CCGGAGTGGATGGCTTCTCACAATCCTCGAGGATTGTGAGAAGCCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019119
PCDHB9 MISSION shRNA Bacterial Glycerol Stock
protocadherin beta 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-400s1c1
Sequence:CCGGCGGCACAAAGAGATGGTCTTACTCGAGTAAGACCATCTCTTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-479s1c1
Sequence:CCGGCAGATGAAGGTCATAACAGTACTCGAGTACTGTTATGACCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-2283s1c1
Sequence:CCGGCGGCGAGTTCAAGTTCTTGAACTCGAGTTCAAGAACTTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1152s1c1
Sequence:CCGGTGTTCAAGATAATCTGCCTTTCTCGAGAAAGGCAGATTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1081s1c1
Sequence:CCGGCCTGGGATAGTATTGGCTGTTCTCGAGAACAGCCAATACTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2725s21c1
Sequence:CCGCATAGTCTGCTGCATGTAATATCTCGAGATATTACATGCAGCAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2498s21c1
Sequence:CCGGCATCTTCAACTTTGCGTATTACTCGAGTAATACGCAAAGTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019119.3-763s21c1
Sequence:CCGGAGTCCAGTAGGGTCCCTTATTCTCGAGAATAAGGGACCCTACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2666s21c1
Sequence:CCGGTTCATTGCCTCTACATTATTCCTCGAGGAATAATGTAGAGGCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019119
PCDHB9 MISSION shRNA shRNA Plasmid DNA
protocadherin beta 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-400s1c1
Sequence:CCGGCGGCACAAAGAGATGGTCTTACTCGAGTAAGACCATCTCTTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-479s1c1
Sequence:CCGGCAGATGAAGGTCATAACAGTACTCGAGTACTGTTATGACCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-2283s1c1
Sequence:CCGGCGGCGAGTTCAAGTTCTTGAACTCGAGTTCAAGAACTTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1152s1c1
Sequence:CCGGTGTTCAAGATAATCTGCCTTTCTCGAGAAAGGCAGATTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1081s1c1
Sequence:CCGGCCTGGGATAGTATTGGCTGTTCTCGAGAACAGCCAATACTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2725s21c1
Sequence:CCGCATAGTCTGCTGCATGTAATATCTCGAGATATTACATGCAGCAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2498s21c1
Sequence:CCGGCATCTTCAACTTTGCGTATTACTCGAGTAATACGCAAAGTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019119.3-763s21c1
Sequence:CCGGAGTCCAGTAGGGTCCCTTATTCTCGAGAATAAGGGACCCTACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2666s21c1
Sequence:CCGGTTCATTGCCTCTACATTATTCCTCGAGGAATAATGTAGAGGCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019119
PCDHB9 MISSION shRNA Lentiviral Transduction Particles
protocadherin beta 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-400s1c1
Sequence:CCGGCGGCACAAAGAGATGGTCTTACTCGAGTAAGACCATCTCTTTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-479s1c1
Sequence:CCGGCAGATGAAGGTCATAACAGTACTCGAGTACTGTTATGACCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-2283s1c1
Sequence:CCGGCGGCGAGTTCAAGTTCTTGAACTCGAGTTCAAGAACTTGAACTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1152s1c1
Sequence:CCGGTGTTCAAGATAATCTGCCTTTCTCGAGAAAGGCAGATTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019119.3-1081s1c1
Sequence:CCGGCCTGGGATAGTATTGGCTGTTCTCGAGAACAGCCAATACTATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2725s21c1
Sequence:CCGCATAGTCTGCTGCATGTAATATCTCGAGATATTACATGCAGCAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2498s21c1
Sequence:CCGGCATCTTCAACTTTGCGTATTACTCGAGTAATACGCAAAGTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019119.3-763s21c1
Sequence:CCGGAGTCCAGTAGGGTCCCTTATTCTCGAGAATAAGGGACCCTACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019119.3-2666s21c1
Sequence:CCGGTTCATTGCCTCTACATTATTCCTCGAGGAATAATGTAGAGGCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks