EMAIL THIS PAGE TO A FRIEND

PCDHGA4

protocadherin gamma subfamily A, 4

Synonyms: PCDH-GAMMA-A4
UniProtKB ID: Q9Y5G9, Q9Y5D3
Gene ID:
Human(56111) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93712) protocadherin gamma subfamily A, 4
Rat(252894) protocadherin gamma subfamily A, 4
naked mole-rat(101706772) protocadherin gamma subfamily A, 4
cow(100337112) protocadherin gamma subfamily A, 4
domestic cat(101097697) protocadherin gamma subfamily A, 4
dog(607550) protocadherin gamma subfamily A, 4
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412853 Anti-PCDHGA4 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing
AV49367 Anti-PCDHGA4 antibody produced in rabbit affinity isolated antibody canine, bovine, human, pig, horse, mouse, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018917 Rosetta Predictions human pricing
NM_032053 Rosetta Predictions human pricing
XM_001056787 Rosetta Predictions rat pricing
NM_033587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052639 predicted 1522
2 SASI_Hs01_00052640 predicted 829
3 SASI_Hs01_00052641 predicted 1536
4 SASI_Hs01_00052642 predicted 1438
5 SASI_Hs01_00052643 predicted 1544
6 SASI_Hs01_00052644 predicted 828
7 SASI_Hs02_00352357 predicted 314
8 SASI_Hs01_00052645 predicted 864
9 SASI_Hs01_00052646 predicted 1583
10 SASI_Hs01_00052647 predicted 1460
11 SASI_Hs01_00052648 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224193 predicted 1520
2 SASI_Hs01_00224194 predicted 823
3 SASI_Hs01_00224195 predicted 1288
4 SASI_Hs01_00224196 predicted 1537
5 SASI_Hs01_00224197 predicted 1442
6 SASI_Hs02_00359254 predicted 1230
7 SASI_Hs01_00224198 predicted 1138
8 SASI_Hs01_00224199 predicted 867
9 SASI_Hs01_00224200 predicted 1582
10 SASI_Hs01_00224201 predicted 1451
11 SASI_Hs01_00224202 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284441 predicted 976
2 SASI_Rn02_00284442 predicted 1237
3 SASI_Rn02_00284443 predicted 504
4 SASI_Rn02_00284444 predicted 856
5 SASI_Rn02_00284445 predicted 1670
6 SASI_Rn02_00284446 predicted 192
7 SASI_Rn02_00284447 predicted 1384
8 SASI_Rn02_00284448 predicted 1713
9 SASI_Rn02_00284449 predicted 2183
10 SASI_Rn02_00284450 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057764 predicted 2657
2 SASI_Mm02_00337441 predicted 2699
3 SASI_Mm01_00057761 predicted 2030
4 SASI_Mm01_00057762 predicted 2356
5 SASI_Mm01_00057763 predicted 1515
6 SASI_Mm01_00057765 predicted 699
7 SASI_Mm01_00057766 predicted 820
8 SASI_Mm01_00057768 predicted 347
9 SASI_Mm01_00057769 predicted 1303
10 SASI_Mm01_00057770 predicted 1237
11 SASI_Mm01_00057767 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018917
PCDHGA4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-1138s21c1
Sequence:CCGGGGCCTAGTCACATGTTCTATTCTCGAGAATAGAACATGTGACTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-351s21c1
Sequence:CCGGGCGGGTAGAGGTGGAAATAATCTCGAGATTATTTCCACCTCTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-676s1c1
Sequence:CCGGGCCAGGATTCTCATAATACTTCTCGAGAAGTATTATGAGAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1363s1c1
Sequence:CCGGGCTTCCTACTCTGCTTACATTCTCGAGAATGTAAGCAGAGTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-88s1c1
Sequence:CCGGCAGATTCTCTACTCGGTGTTTCTCGAGAAACACCGAGTAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-510s1c1
Sequence:CCGGCCAGCTCAACTCAAACGGTTACTCGAGTAACCGTTTGAGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1085s1c1
Sequence:CCGGCGGGTACAGTAATTGCACTTTCTCGAGAAAGTGCAATTACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018917
PCDHGA4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-1138s21c1
Sequence:CCGGGGCCTAGTCACATGTTCTATTCTCGAGAATAGAACATGTGACTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-351s21c1
Sequence:CCGGGCGGGTAGAGGTGGAAATAATCTCGAGATTATTTCCACCTCTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-676s1c1
Sequence:CCGGGCCAGGATTCTCATAATACTTCTCGAGAAGTATTATGAGAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1363s1c1
Sequence:CCGGGCTTCCTACTCTGCTTACATTCTCGAGAATGTAAGCAGAGTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-88s1c1
Sequence:CCGGCAGATTCTCTACTCGGTGTTTCTCGAGAAACACCGAGTAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-510s1c1
Sequence:CCGGCCAGCTCAACTCAAACGGTTACTCGAGTAACCGTTTGAGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1085s1c1
Sequence:CCGGCGGGTACAGTAATTGCACTTTCTCGAGAAAGTGCAATTACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018917
PCDHGA4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-1138s21c1
Sequence:CCGGGGCCTAGTCACATGTTCTATTCTCGAGAATAGAACATGTGACTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018917.2-351s21c1
Sequence:CCGGGCGGGTAGAGGTGGAAATAATCTCGAGATTATTTCCACCTCTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-676s1c1
Sequence:CCGGGCCAGGATTCTCATAATACTTCTCGAGAAGTATTATGAGAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1363s1c1
Sequence:CCGGGCTTCCTACTCTGCTTACATTCTCGAGAATGTAAGCAGAGTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-88s1c1
Sequence:CCGGCAGATTCTCTACTCGGTGTTTCTCGAGAAACACCGAGTAGAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-510s1c1
Sequence:CCGGCCAGCTCAACTCAAACGGTTACTCGAGTAACCGTTTGAGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018917.2-1085s1c1
Sequence:CCGGCGGGTACAGTAATTGCACTTTCTCGAGAAAGTGCAATTACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033587
PCDHGA4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-357s21c1
Sequence:CCGGAGTGGAGATTATCGATGTTAACTCGAGTTAACATCGATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1313s21c1
Sequence:CCGGCATTGCAGGTGGTAGATATTACTCGAGTAATATCTACCACCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-771s21c1
Sequence:CCGGCACCCGGCTGCTTACCATAAACTCGAGTTTATGGTAAGCAGCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1445s21c1
Sequence:CCGGAGAATGCCCAGGTTATCTATTCTCGAGAATAGATAACCTGGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-815s21c1
Sequence:CCGGTCAACGGAGAAGTGACGTATTCTCGAGAATACGTCACTTCTCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033587.2-4318s1c1
Sequence:CCGGCCTTACAGTAGTGTAGAAGATCTCGAGATCTTCTACACTACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-2500s1c1
Sequence:CCGGGTATCTCAAGACTTGCTTGAACTCGAGTTCAAGCAAGTCTTGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-1330s1c1
Sequence:CCGGCGGTTGTTGATACACAGGACTCTCGAGAGTCCTGTGTATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-945s1c1
Sequence:CCGGCGGAGAAGTGACGTATTCTTTCTCGAGAAAGAATACGTCACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-450s1c1
Sequence:CCGGCCTAGAGGATAAAGTGAGGATCTCGAGATCCTCACTTTATCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033587
PCDHGA4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-357s21c1
Sequence:CCGGAGTGGAGATTATCGATGTTAACTCGAGTTAACATCGATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1313s21c1
Sequence:CCGGCATTGCAGGTGGTAGATATTACTCGAGTAATATCTACCACCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-771s21c1
Sequence:CCGGCACCCGGCTGCTTACCATAAACTCGAGTTTATGGTAAGCAGCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1445s21c1
Sequence:CCGGAGAATGCCCAGGTTATCTATTCTCGAGAATAGATAACCTGGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-815s21c1
Sequence:CCGGTCAACGGAGAAGTGACGTATTCTCGAGAATACGTCACTTCTCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033587.2-4318s1c1
Sequence:CCGGCCTTACAGTAGTGTAGAAGATCTCGAGATCTTCTACACTACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-2500s1c1
Sequence:CCGGGTATCTCAAGACTTGCTTGAACTCGAGTTCAAGCAAGTCTTGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-1330s1c1
Sequence:CCGGCGGTTGTTGATACACAGGACTCTCGAGAGTCCTGTGTATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-945s1c1
Sequence:CCGGCGGAGAAGTGACGTATTCTTTCTCGAGAAAGAATACGTCACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-450s1c1
Sequence:CCGGCCTAGAGGATAAAGTGAGGATCTCGAGATCCTCACTTTATCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033587
PCDHGA4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-357s21c1
Sequence:CCGGAGTGGAGATTATCGATGTTAACTCGAGTTAACATCGATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1313s21c1
Sequence:CCGGCATTGCAGGTGGTAGATATTACTCGAGTAATATCTACCACCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-771s21c1
Sequence:CCGGCACCCGGCTGCTTACCATAAACTCGAGTTTATGGTAAGCAGCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-1445s21c1
Sequence:CCGGAGAATGCCCAGGTTATCTATTCTCGAGAATAGATAACCTGGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033587.3-815s21c1
Sequence:CCGGTCAACGGAGAAGTGACGTATTCTCGAGAATACGTCACTTCTCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033587.2-4318s1c1
Sequence:CCGGCCTTACAGTAGTGTAGAAGATCTCGAGATCTTCTACACTACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-2500s1c1
Sequence:CCGGGTATCTCAAGACTTGCTTGAACTCGAGTTCAAGCAAGTCTTGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-1330s1c1
Sequence:CCGGCGGTTGTTGATACACAGGACTCTCGAGAGTCCTGTGTATCAACAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-945s1c1
Sequence:CCGGCGGAGAAGTGACGTATTCTTTCTCGAGAAAGAATACGTCACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033587.2-450s1c1
Sequence:CCGGCCTAGAGGATAAAGTGAGGATCTCGAGATCCTCACTTTATCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks