EMAIL THIS PAGE TO A FRIEND

PCDHGA7

protocadherin gamma subfamily A, 7

Synonyms: PCDH-GAMMA-A7
UniProtKB ID: Q9Y5G6, B2RN87, Q9Y5D0
Gene ID:
Human(56108) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93715) protocadherin gamma subfamily A, 7
Rat(291635) protocadherin gamma subfamily A, 7
Horse(100146847) protocadherin gamma subfamily A, 7
domestic cat(101098921) protocadherin gamma subfamily A, 7
dog(487182) protocadherin gamma subfamily A, 7
cow(100848257) protocadherin gamma subfamily A, 7
sheep(101103320) protocadherin gamma subfamily A, 7
domestic guinea pig(100720818) protocadherin gamma subfamily A, 7
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018920 Rosetta Predictions human pricing
NM_032087 Rosetta Predictions human pricing
NM_001014773 Rosetta Predictions rat pricing
NM_033590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241416 predicted 3201
2 SASI_Hs01_00241418 predicted 3223
3 SASI_Hs01_00241420 predicted 2867
4 SASI_Hs02_00352362 predicted 3174
5 SASI_Hs01_00241421 predicted 3063
6 SASI_Hs01_00241423 predicted 3223
7 SASI_Hs01_00241424 predicted 3011
8 SASI_Hs01_00241425 predicted 3270
9 SASI_Hs02_00352363 predicted 3048
10 SASI_Hs02_00352364 predicted 2871
11 SASI_Hs01_00241417 predicted 2671
12 SASI_Hs01_00241419 predicted 2688
13 SASI_Hs01_00241422 predicted 2713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210509 predicted 1839
2 SASI_Hs01_00210510 predicted 883
3 SASI_Hs01_00210511 predicted 1438
4 SASI_Hs02_00359259 predicted 387
5 SASI_Hs01_00210512 predicted 1807
6 SASI_Hs01_00210513 predicted 1244
7 SASI_Hs01_00210514 predicted 1241
8 SASI_Hs01_00210515 predicted 1369
9 SASI_Hs01_00210516 predicted 360
10 SASI_Hs01_00210517 predicted 1058
11 SASI_Hs01_00210518 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085517 predicted 2870
2 SASI_Rn01_00085518 predicted 1657
3 SASI_Rn01_00085519 predicted 995
4 SASI_Rn01_00085520 predicted 2524
5 SASI_Rn01_00085521 predicted 982
6 SASI_Rn01_00085522 predicted 2457
7 SASI_Rn01_00085523 predicted 2336
8 SASI_Rn02_00201862 predicted 1508
9 SASI_Rn01_00085524 predicted 293
10 SASI_Rn01_00085526 predicted 2492
11 SASI_Rn01_00085525 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191992 predicted 2774
2 SASI_Mm02_00337447 predicted 2826
3 SASI_Mm01_00191993 predicted 1573
4 SASI_Mm01_00191994 predicted 1324
5 SASI_Mm01_00191995 predicted 2273
6 SASI_Mm02_00337448 predicted 963
7 SASI_Mm01_00191997 predicted 196
8 SASI_Mm01_00191998 predicted 443
9 SASI_Mm02_00337449 predicted 410
10 SASI_Mm01_00191999 predicted 898
11 SASI_Mm01_00191996 predicted 887
12 SASI_Mm01_00192000 predicted 1492
13 SASI_Mm01_00192001 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033590
PCDHGA7 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033590.2-4349s1c1
Sequence:CCGGGCGTAGAATAGCCAATAGTATCTCGAGATACTATTGGCTATTCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-887s1c1
Sequence:CCGGGCACAAGACTTCTCACTGTAACTCGAGTTACAGTGAGAAGTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-2355s1c1
Sequence:CCGGCCAGGCTTTCCTACAAACATACTCGAGTATGTTTGTAGGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-1473s1c1
Sequence:CCGGCGACTCTTCTTACTCTATCTACTCGAGTAGATAGAGTAAGAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-502s1c1
Sequence:CCGGGCTCCCAGATTCTTAACAGAACTCGAGTTCTGTTAAGAATCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1661s21c1
Sequence:CCGGCACTTGGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1006s21c1
Sequence:CCGGACAGGAGAGCTGTCGACTTTACTCGAGTAAAGTCGACAGCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-414s21c1
Sequence:CCGGGCGATGTCTCGTGAGCTTTAACTCGAGTTAAAGCTCACGAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1639s21c1
Sequence:CCGGTCTGACACGGGTATCCTATATCTCGAGATATAGGATACCCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1293s21c1
Sequence:CCGGGTTAGAGCGATCAATTGATAACTCGAGTTATCAATTGATCGCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033590
PCDHGA7 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033590.2-4349s1c1
Sequence:CCGGGCGTAGAATAGCCAATAGTATCTCGAGATACTATTGGCTATTCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-887s1c1
Sequence:CCGGGCACAAGACTTCTCACTGTAACTCGAGTTACAGTGAGAAGTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-2355s1c1
Sequence:CCGGCCAGGCTTTCCTACAAACATACTCGAGTATGTTTGTAGGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-1473s1c1
Sequence:CCGGCGACTCTTCTTACTCTATCTACTCGAGTAGATAGAGTAAGAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-502s1c1
Sequence:CCGGGCTCCCAGATTCTTAACAGAACTCGAGTTCTGTTAAGAATCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1661s21c1
Sequence:CCGGCACTTGGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1006s21c1
Sequence:CCGGACAGGAGAGCTGTCGACTTTACTCGAGTAAAGTCGACAGCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-414s21c1
Sequence:CCGGGCGATGTCTCGTGAGCTTTAACTCGAGTTAAAGCTCACGAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1639s21c1
Sequence:CCGGTCTGACACGGGTATCCTATATCTCGAGATATAGGATACCCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1293s21c1
Sequence:CCGGGTTAGAGCGATCAATTGATAACTCGAGTTATCAATTGATCGCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033590
PCDHGA7 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033590.2-4349s1c1
Sequence:CCGGGCGTAGAATAGCCAATAGTATCTCGAGATACTATTGGCTATTCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-887s1c1
Sequence:CCGGGCACAAGACTTCTCACTGTAACTCGAGTTACAGTGAGAAGTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-2355s1c1
Sequence:CCGGCCAGGCTTTCCTACAAACATACTCGAGTATGTTTGTAGGAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-1473s1c1
Sequence:CCGGCGACTCTTCTTACTCTATCTACTCGAGTAGATAGAGTAAGAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033590.2-502s1c1
Sequence:CCGGGCTCCCAGATTCTTAACAGAACTCGAGTTCTGTTAAGAATCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1661s21c1
Sequence:CCGGCACTTGGATCCTTCGACTATGCTCGAGCATAGTCGAAGGATCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1006s21c1
Sequence:CCGGACAGGAGAGCTGTCGACTTTACTCGAGTAAAGTCGACAGCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-414s21c1
Sequence:CCGGGCGATGTCTCGTGAGCTTTAACTCGAGTTAAAGCTCACGAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1639s21c1
Sequence:CCGGTCTGACACGGGTATCCTATATCTCGAGATATAGGATACCCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033590.3-1293s21c1
Sequence:CCGGGTTAGAGCGATCAATTGATAACTCGAGTTATCAATTGATCGCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018920
PCDHGA7 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018920.2-3345s1c1
Sequence:CCGGCCCAAGATCAATGCTCAAGTTCTCGAGAACTTGAGCATTGATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-559s1c1
Sequence:CCGGGATGAAACTAAGTACCCGGAACTCGAGTTCCGGGTACTTAGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-1296s1c1
Sequence:CCGGGTCCAGGGAAACTCACATATTCTCGAGAATATGTGAGTTTCCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-882s1c1
Sequence:CCGGGAACTCGCTTACAGGAGAAATCTCGAGATTTCTCCTGTAAGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018920
PCDHGA7 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018920.2-3345s1c1
Sequence:CCGGCCCAAGATCAATGCTCAAGTTCTCGAGAACTTGAGCATTGATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-559s1c1
Sequence:CCGGGATGAAACTAAGTACCCGGAACTCGAGTTCCGGGTACTTAGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-1296s1c1
Sequence:CCGGGTCCAGGGAAACTCACATATTCTCGAGAATATGTGAGTTTCCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-882s1c1
Sequence:CCGGGAACTCGCTTACAGGAGAAATCTCGAGATTTCTCCTGTAAGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018920
PCDHGA7 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018920.2-3345s1c1
Sequence:CCGGCCCAAGATCAATGCTCAAGTTCTCGAGAACTTGAGCATTGATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-559s1c1
Sequence:CCGGGATGAAACTAAGTACCCGGAACTCGAGTTCCGGGTACTTAGTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-1296s1c1
Sequence:CCGGGTCCAGGGAAACTCACATATTCTCGAGAATATGTGAGTTTCCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018920.2-882s1c1
Sequence:CCGGGAACTCGCTTACAGGAGAAATCTCGAGATTTCTCCTGTAAGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks