EMAIL THIS PAGE TO A FRIEND

PCDHGA8

protocadherin gamma subfamily A, 8

Synonyms: PCDH-GAMMA-A8
UniProtKB ID: Q9Y5G5, A7MCZ4, O15039
Gene ID:
Human(9708) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93716) protocadherin gamma subfamily A, 8
Rat(364843) protocadherin gamma subfamily A, 8
domestic guinea pig(100721363) protocadherin gamma subfamily A, 8
cow(521340) protocadherin gamma subfamily A, 8
sheep(101103568) protocadherin gamma subfamily A, 8
Zebrafish(100536703) protocadherin gamma subfamily A, 8
domestic cat(101099427) protocadherin gamma subfamily A, 8
dog(607612) protocadherin gamma subfamily A, 8
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014004 Rosetta Predictions human pricing
NM_032088 Rosetta Predictions human pricing
NM_001037156 Rosetta Predictions rat pricing
NM_033591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156160 predicted 2263
2 SASI_Hs01_00156161 predicted 2270
3 SASI_Hs01_00156163 predicted 2192
4 SASI_Hs02_00344973 predicted 2109
5 SASI_Hs01_00156164 predicted 2079
6 SASI_Hs01_00156165 predicted 2037
7 SASI_Hs01_00156166 predicted 2142
8 SASI_Hs01_00156167 predicted 1338
9 SASI_Hs01_00156169 predicted 2355
10 SASI_Hs02_00344974 predicted 1319
11 SASI_Hs01_00156162 predicted 2045
12 SASI_Hs01_00156168 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071593 predicted 2257
2 SASI_Hs01_00071594 predicted 2265
3 SASI_Hs01_00071596 predicted 2188
4 SASI_Hs02_00359260 predicted 2115
5 SASI_Hs01_00071597 predicted 2081
6 SASI_Hs01_00071598 predicted 2036
7 SASI_Hs01_00071599 predicted 2133
8 SASI_Hs01_00071600 predicted 1345
9 SASI_Hs01_00071602 predicted 2351
10 SASI_Hs02_00359261 predicted 1325
11 SASI_Hs01_00071595 predicted 2043
12 SASI_Hs01_00071601 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062622 predicted 2803
2 SASI_Rn01_00062623 predicted 1063
3 SASI_Rn01_00062624 predicted 422
4 SASI_Rn01_00062625 predicted 1043
5 SASI_Rn02_00204241 predicted 1351
6 SASI_Rn02_00204242 predicted 1001
7 SASI_Rn01_00062626 predicted 2421
8 SASI_Rn01_00062627 predicted 982
9 SASI_Rn01_00062628 predicted 505
10 SASI_Rn01_00062629 predicted 1451
11 SASI_Rn01_00062630 predicted 1324
12 SASI_Rn01_00062631 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040834 predicted 2199
2 SASI_Mm01_00040835 predicted 1430
3 SASI_Mm01_00040836 predicted 1077
4 SASI_Mm01_00040837 predicted 2848
5 SASI_Mm01_00040838 predicted 1014
6 SASI_Mm01_00040839 predicted 1216
7 SASI_Mm01_00040840 predicted 1422
8 SASI_Mm01_00040841 predicted 1441
9 SASI_Mm01_00040842 predicted 2469
10 SASI_Mm01_00040843 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014004
PCDHGA8 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-2955s21c1
Sequence:CCGGATTCGAGCCTTACACTCTATCCTCGAGGATAGAGTGTAAGGCTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1300s21c1
Sequence:CCGGGGTCGAAGATCTAGAAGTAAACTCGAGTTTACTTCTAGATCTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1984s1c1
Sequence:CCGGCGGGACAGTAATTGCCTTCTTCTCGAGAAGAAGGCAATTACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1766s1c1
Sequence:CCGGCCGTTATTCCAGCTTAATGAACTCGAGTTCATTAAGCTGGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1198s1c1
Sequence:CCGGGCGGTGTCTGATAAATATTAACTCGAGTTAATATTTATCAGACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1585s1c1
Sequence:CCGGCGTGACAGTGTTGGATACAAACTCGAGTTTGTATCCAACACTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-3327s1c1
Sequence:CCGGGTTTAGTTCTTTGCTTGCTTTCTCGAGAAAGCAAGCAAAGAACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1934s21c1
Sequence:CCGGGAAGTGATCATTACGTCTTTGCTCGAGCAAAGACGTAATGATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014004
PCDHGA8 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-2955s21c1
Sequence:CCGGATTCGAGCCTTACACTCTATCCTCGAGGATAGAGTGTAAGGCTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1300s21c1
Sequence:CCGGGGTCGAAGATCTAGAAGTAAACTCGAGTTTACTTCTAGATCTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1984s1c1
Sequence:CCGGCGGGACAGTAATTGCCTTCTTCTCGAGAAGAAGGCAATTACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1766s1c1
Sequence:CCGGCCGTTATTCCAGCTTAATGAACTCGAGTTCATTAAGCTGGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1198s1c1
Sequence:CCGGGCGGTGTCTGATAAATATTAACTCGAGTTAATATTTATCAGACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1585s1c1
Sequence:CCGGCGTGACAGTGTTGGATACAAACTCGAGTTTGTATCCAACACTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-3327s1c1
Sequence:CCGGGTTTAGTTCTTTGCTTGCTTTCTCGAGAAAGCAAGCAAAGAACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1934s21c1
Sequence:CCGGGAAGTGATCATTACGTCTTTGCTCGAGCAAAGACGTAATGATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014004
PCDHGA8 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-2955s21c1
Sequence:CCGGATTCGAGCCTTACACTCTATCCTCGAGGATAGAGTGTAAGGCTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1300s21c1
Sequence:CCGGGGTCGAAGATCTAGAAGTAAACTCGAGTTTACTTCTAGATCTTCGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1984s1c1
Sequence:CCGGCGGGACAGTAATTGCCTTCTTCTCGAGAAGAAGGCAATTACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1766s1c1
Sequence:CCGGCCGTTATTCCAGCTTAATGAACTCGAGTTCATTAAGCTGGAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1198s1c1
Sequence:CCGGGCGGTGTCTGATAAATATTAACTCGAGTTAATATTTATCAGACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-1585s1c1
Sequence:CCGGCGTGACAGTGTTGGATACAAACTCGAGTTTGTATCCAACACTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014004.2-3327s1c1
Sequence:CCGGGTTTAGTTCTTTGCTTGCTTTCTCGAGAAAGCAAGCAAAGAACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014004.2-1934s21c1
Sequence:CCGGGAAGTGATCATTACGTCTTTGCTCGAGCAAAGACGTAATGATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033591
PCDHGA8 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033591.2-4259s1c1
Sequence:CCGGCCTTACCAGGTGCCATTTCTTCTCGAGAAGAAATGGCACCTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-2568s1c1
Sequence:CCGGCCATAGATTTCCATGAGAATACTCGAGTATTCTCATGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-483s1c1
Sequence:CCGGGCACGCCTTGTCTTGTAAATACTCGAGTATTTACAAGACAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1345s1c1
Sequence:CCGGGCATGATAACTTACCCTTTAACTCGAGTTAAAGGGTAAGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1333s1c1
Sequence:CCGGTGTCTGTTACACGCATGATAACTCGAGTTATCATGCGTGTAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033591
PCDHGA8 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033591.2-4259s1c1
Sequence:CCGGCCTTACCAGGTGCCATTTCTTCTCGAGAAGAAATGGCACCTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-2568s1c1
Sequence:CCGGCCATAGATTTCCATGAGAATACTCGAGTATTCTCATGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-483s1c1
Sequence:CCGGGCACGCCTTGTCTTGTAAATACTCGAGTATTTACAAGACAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1345s1c1
Sequence:CCGGGCATGATAACTTACCCTTTAACTCGAGTTAAAGGGTAAGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1333s1c1
Sequence:CCGGTGTCTGTTACACGCATGATAACTCGAGTTATCATGCGTGTAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033591
PCDHGA8 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033591.2-4259s1c1
Sequence:CCGGCCTTACCAGGTGCCATTTCTTCTCGAGAAGAAATGGCACCTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-2568s1c1
Sequence:CCGGCCATAGATTTCCATGAGAATACTCGAGTATTCTCATGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-483s1c1
Sequence:CCGGGCACGCCTTGTCTTGTAAATACTCGAGTATTTACAAGACAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1345s1c1
Sequence:CCGGGCATGATAACTTACCCTTTAACTCGAGTTAAAGGGTAAGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033591.2-1333s1c1
Sequence:CCGGTGTCTGTTACACGCATGATAACTCGAGTTATCATGCGTGTAACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks