EMAIL THIS PAGE TO A FRIEND

PCDHGB2

protocadherin gamma subfamily B, 2

Synonyms: PCDH-GAMMA-B2
UniProtKB ID: Q9Y5G2, Q3MIJ3, Q9UN65
Gene ID:
Human(56103) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93700) protocadherin gamma subfamily B, 2
Rat(680361) protocadherin gamma subfamily B, 2
dog(100684038) protocadherin gamma subfamily B, 2
Horse(100072255) protocadherin gamma subfamily B, 2
domestic cat(101097943) protocadherin gamma subfamily B, 2
cow(100848197) protocadherin gamma subfamily B, 2
cow(100337121) protocadherin gamma subfamily B, 2
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305182 ANTI-PCDHGB2(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
WH0056103M2 Monoclonal Anti-PCDHGB2 antibody produced in mouse clone 6E9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201311 Monoclonal Anti-Protocadherin - Alkaline Phosphatase antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201312 Monoclonal Anti-Protocadherin - Apc antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201303 Monoclonal Anti-Protocadherin - Atto 390 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201304 Monoclonal Anti-Protocadherin - Atto 488 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201305 Monoclonal Anti-Protocadherin - Atto 565 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201306 Monoclonal Anti-Protocadherin - Atto 594 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201307 Monoclonal Anti-Protocadherin - Atto 633 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201308 Monoclonal Anti-Protocadherin - Atto 655 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201309 Monoclonal Anti-Protocadherin - Atto 680 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201310 Monoclonal Anti-Protocadherin - Atto 700 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201313 Monoclonal Anti-Protocadherin - Biotin antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201314 Monoclonal Anti-Protocadherin - Fitc antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201315 Monoclonal Anti-Protocadherin - Hrp antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201316 Monoclonal Anti-Protocadherin - Pe/Atto 594 antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201317 Monoclonal Anti-Protocadherin - Percp antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201318 Monoclonal Anti-Protocadherin - Rpe antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201319 Monoclonal Anti-Protocadherin - Streptavidin antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201302 Monoclonal Anti-Protocadherin antibody produced in mouse clone S148-30, purified immunoglobulin mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018923 Rosetta Predictions human pricing
NM_032096 Rosetta Predictions human pricing
XM_574133 Rosetta Predictions rat pricing
NM_033575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352371 predicted 969
2 SASI_Hs01_00064810 predicted 803
3 SASI_Hs01_00064811 predicted 1976
4 SASI_Hs01_00064812 predicted 1140
5 SASI_Hs02_00352372 predicted 353
6 SASI_Hs01_00064813 predicted 508
7 SASI_Hs01_00064814 predicted 938
8 SASI_Hs01_00064815 predicted 1398
9 SASI_Hs01_00064816 predicted 928
10 SASI_Hs01_00064818 predicted 1012
11 SASI_Hs01_00064817 predicted 856
12 SASI_Hs01_00064819 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359278 predicted 971
2 SASI_Hs01_00205301 predicted 799
3 SASI_Hs01_00205302 predicted 1975
4 SASI_Hs01_00205303 predicted 1131
5 SASI_Hs02_00359279 predicted 352
6 SASI_Hs01_00205304 predicted 506
7 SASI_Hs01_00205305 predicted 935
8 SASI_Hs01_00205306 predicted 1405
9 SASI_Hs01_00205307 predicted 924
10 SASI_Hs01_00205309 predicted 1018
11 SASI_Hs01_00205308 predicted 858
12 SASI_Hs01_00205310 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401451 predicted 1191
2 SASI_Rn02_00401452 predicted 936
3 SASI_Rn02_00401453 predicted 1237
4 SASI_Rn02_00401454 predicted 1430
5 SASI_Rn02_00401455 predicted 1565
6 SASI_Rn02_00401456 predicted 1556
7 SASI_Rn02_00401457 predicted 2438
8 SASI_Rn02_00401458 predicted 808
9 SASI_Rn02_00401459 predicted 1101
10 SASI_Rn02_00401460 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092215 predicted 2748
2 SASI_Mm02_00337411 predicted 2797
3 SASI_Mm01_00092214 predicted 2371
4 SASI_Mm01_00092216 predicted 661
5 SASI_Mm01_00092217 predicted 1403
6 SASI_Mm01_00092218 predicted 1587
7 SASI_Mm01_00092219 predicted 918
8 SASI_Mm01_00092220 predicted 1269
9 SASI_Mm01_00092221 predicted 1106
10 SASI_Mm01_00092222 predicted 1011
11 SASI_Mm01_00092223 predicted 2401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018923
PCDHGB2 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-390s1c1
Sequence:CCGGCCCGCTATTCAAACAGACTAACTCGAGTTAGTCTGTTTGAATAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-510s1c1
Sequence:CCGGCCACCTTAATGACAACGAGTACTCGAGTACTCGTTGTCATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-2222s1c1
Sequence:CCGGCCAATTACAGTGAGGGTACATCTCGAGATGTACCCTCACTGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-358s1c1
Sequence:CCGGGCAGTAATTGTGCAGGATATACTCGAGTATATCCTGCACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-905s1c1
Sequence:CCGGCGACAAAGGATGATTTGGATTCTCGAGAATCCAAATCATCCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-91s21c1
Sequence:CCGGGTCCAGATCCGCTATTCAATTCTCGAGAATTGAATAGCGGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-1023s21c1
Sequence:CCGGCGATTGTGCACCTGAAGTTATCTCGAGATAACTTCAGGTGCACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-551s21c1
Sequence:CCGGAGACTCCAGATGGTCGTAAATCTCGAGATTTACGACCATCTGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018923
PCDHGB2 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-390s1c1
Sequence:CCGGCCCGCTATTCAAACAGACTAACTCGAGTTAGTCTGTTTGAATAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-510s1c1
Sequence:CCGGCCACCTTAATGACAACGAGTACTCGAGTACTCGTTGTCATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-2222s1c1
Sequence:CCGGCCAATTACAGTGAGGGTACATCTCGAGATGTACCCTCACTGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-358s1c1
Sequence:CCGGGCAGTAATTGTGCAGGATATACTCGAGTATATCCTGCACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-905s1c1
Sequence:CCGGCGACAAAGGATGATTTGGATTCTCGAGAATCCAAATCATCCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-91s21c1
Sequence:CCGGGTCCAGATCCGCTATTCAATTCTCGAGAATTGAATAGCGGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-1023s21c1
Sequence:CCGGCGATTGTGCACCTGAAGTTATCTCGAGATAACTTCAGGTGCACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-551s21c1
Sequence:CCGGAGACTCCAGATGGTCGTAAATCTCGAGATTTACGACCATCTGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018923
PCDHGB2 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-390s1c1
Sequence:CCGGCCCGCTATTCAAACAGACTAACTCGAGTTAGTCTGTTTGAATAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-510s1c1
Sequence:CCGGCCACCTTAATGACAACGAGTACTCGAGTACTCGTTGTCATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-2222s1c1
Sequence:CCGGCCAATTACAGTGAGGGTACATCTCGAGATGTACCCTCACTGTAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-358s1c1
Sequence:CCGGGCAGTAATTGTGCAGGATATACTCGAGTATATCCTGCACAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018923.2-905s1c1
Sequence:CCGGCGACAAAGGATGATTTGGATTCTCGAGAATCCAAATCATCCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-91s21c1
Sequence:CCGGGTCCAGATCCGCTATTCAATTCTCGAGAATTGAATAGCGGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-1023s21c1
Sequence:CCGGCGATTGTGCACCTGAAGTTATCTCGAGATAACTTCAGGTGCACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018923.2-551s21c1
Sequence:CCGGAGACTCCAGATGGTCGTAAATCTCGAGATTTACGACCATCTGGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033575
PCDHGB2 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1083s1c1
Sequence:CCGGCCATTGTAGTATCCAAGTGAACTCGAGTTCACTTGGATACTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-566s1c1
Sequence:CCGGCCCTCGATTTAGATGCTGGTTCTCGAGAACCAGCATCTAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1084s1c1
Sequence:CCGGCATTGTAGTATCCAAGTGAAACTCGAGTTTCACTTGGATACTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1030s1c1
Sequence:CCGGGCTAAGAGTTACACCCTGAATCTCGAGATTCAGGGTGTAACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033575.2-3504s1c1
Sequence:CCGGCCTCTGGTACTGATGATGCTTCTCGAGAAGCATCATCAGTACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033575
PCDHGB2 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1083s1c1
Sequence:CCGGCCATTGTAGTATCCAAGTGAACTCGAGTTCACTTGGATACTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-566s1c1
Sequence:CCGGCCCTCGATTTAGATGCTGGTTCTCGAGAACCAGCATCTAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1084s1c1
Sequence:CCGGCATTGTAGTATCCAAGTGAAACTCGAGTTTCACTTGGATACTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1030s1c1
Sequence:CCGGGCTAAGAGTTACACCCTGAATCTCGAGATTCAGGGTGTAACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033575.2-3504s1c1
Sequence:CCGGCCTCTGGTACTGATGATGCTTCTCGAGAAGCATCATCAGTACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033575
PCDHGB2 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1083s1c1
Sequence:CCGGCCATTGTAGTATCCAAGTGAACTCGAGTTCACTTGGATACTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-566s1c1
Sequence:CCGGCCCTCGATTTAGATGCTGGTTCTCGAGAACCAGCATCTAAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1084s1c1
Sequence:CCGGCATTGTAGTATCCAAGTGAAACTCGAGTTTCACTTGGATACTACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033575.2-1030s1c1
Sequence:CCGGGCTAAGAGTTACACCCTGAATCTCGAGATTCAGGGTGTAACTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033575.2-3504s1c1
Sequence:CCGGCCTCTGGTACTGATGATGCTTCTCGAGAAGCATCATCAGTACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks