EMAIL THIS PAGE TO A FRIEND

PCED1B

PC-esterase domain containing 1B

Synonyms: FAM113B
UniProtKB ID: Q96HM7, Q96B20
Gene ID:
Mouse(239647) PC-esterase domain containing 1B
Rat(315283) PC-esterase domain containing 1B
dog(100688299) PC-esterase domain containing 1B
domestic cat(101086732) PC-esterase domain containing 1B
cow(540367) PC-esterase domain containing 1B
sheep(101110924) PC-esterase domain containing 1B
domestic guinea pig(100724503) PC-esterase domain containing 1B
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043901 Anti-PCED1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125651 MISSION® esiRNA esiRNA human FAM113B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138371 Rosetta Predictions human pricing
NM_001039454 Rosetta Predictions rat pricing
NM_172293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145594 predicted 1780
2 SASI_Hs01_00145595 predicted 540
3 SASI_Hs01_00145596 predicted 678
4 SASI_Hs01_00145597 predicted 604
5 SASI_Hs01_00145598 predicted 1788
6 SASI_Hs01_00145599 predicted 482
7 SASI_Hs01_00145601 predicted 1763
8 SASI_Hs01_00145602 predicted 1756
9 SASI_Hs02_00363484 predicted 941
10 SASI_Hs02_00363485 predicted 970
11 SASI_Hs01_00145593 predicted 1778
12 SASI_Hs01_00145600 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052074 predicted 410
2 SASI_Rn01_00052075 predicted 801
3 SASI_Rn01_00052076 predicted 769
4 SASI_Rn02_00204839 predicted 1773
5 SASI_Rn01_00052078 predicted 747
6 SASI_Rn01_00052079 predicted 641
7 SASI_Rn01_00052080 predicted 898
8 SASI_Rn02_00204840 predicted 932
9 SASI_Rn01_00052082 predicted 517
10 SASI_Rn01_00052083 predicted 834
11 SASI_Rn01_00052077 predicted 444
12 SASI_Rn01_00052081 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343779 predicted 1637
2 SASI_Mm01_00099313 predicted 1170
3 SASI_Mm01_00099314 predicted 1173
4 SASI_Mm01_00099315 predicted 1079
5 SASI_Mm01_00099316 predicted 1225
6 SASI_Mm01_00099317 predicted 596
7 SASI_Mm01_00099318 predicted 1051
8 SASI_Mm02_00343780 predicted 1668
9 SASI_Mm01_00099321 predicted 652
10 SASI_Mm02_00343781 predicted 977
11 SASI_Mm01_00099319 predicted 1083
12 SASI_Mm01_00099320 predicted 1079
13 SASI_Mm01_00099322 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138371
VALIDATED
PCED1B MISSION shRNA Bacterial Glycerol Stock
PC-esterase domain containing 1B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1776s21c1
Sequence:CCGGAGACGGACCTAGGCCTTATTTCTCGAGAAATAAGGCCTAGGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1575s21c1
Sequence:CCGGGTTTCTTCGTCGAAGACAATTCTCGAGAATTGTCTTCGACGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1940s1c1
Sequence:CCGGGCAGCCTGACTCATTCTTCTTCTCGAGAAGAAGAATGAGTCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1088s1c1
Sequence:CCGGGCACGTAAACATAACTTCGATCTCGAGATCGAAGTTATGTTTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1051s1c1
Sequence:CCGGCGAAGTGGTCAAAGCCAACTTCTCGAGAAGTTGGCTTTGACCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-789s1c1
Sequence:CCGGCCATCTTGAAAGAGCTGCAGTCTCGAGACTGCAGCTCTTTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-547s1c1
Sequence:CCGGCTCTGTGCATAGGGCAGTATACTCGAGTATACTGCCCTATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138371
VALIDATED
PCED1B MISSION shRNA shRNA Plasmid DNA
PC-esterase domain containing 1B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1776s21c1
Sequence:CCGGAGACGGACCTAGGCCTTATTTCTCGAGAAATAAGGCCTAGGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1575s21c1
Sequence:CCGGGTTTCTTCGTCGAAGACAATTCTCGAGAATTGTCTTCGACGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1940s1c1
Sequence:CCGGGCAGCCTGACTCATTCTTCTTCTCGAGAAGAAGAATGAGTCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1088s1c1
Sequence:CCGGGCACGTAAACATAACTTCGATCTCGAGATCGAAGTTATGTTTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1051s1c1
Sequence:CCGGCGAAGTGGTCAAAGCCAACTTCTCGAGAAGTTGGCTTTGACCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-789s1c1
Sequence:CCGGCCATCTTGAAAGAGCTGCAGTCTCGAGACTGCAGCTCTTTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-547s1c1
Sequence:CCGGCTCTGTGCATAGGGCAGTATACTCGAGTATACTGCCCTATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138371
VALIDATED
PCED1B MISSION shRNA Lentiviral Transduction Particles
PC-esterase domain containing 1B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1776s21c1
Sequence:CCGGAGACGGACCTAGGCCTTATTTCTCGAGAAATAAGGCCTAGGTCCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138371.1-1575s21c1
Sequence:CCGGGTTTCTTCGTCGAAGACAATTCTCGAGAATTGTCTTCGACGAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1940s1c1
Sequence:CCGGGCAGCCTGACTCATTCTTCTTCTCGAGAAGAAGAATGAGTCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1088s1c1
Sequence:CCGGGCACGTAAACATAACTTCGATCTCGAGATCGAAGTTATGTTTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-1051s1c1
Sequence:CCGGCGAAGTGGTCAAAGCCAACTTCTCGAGAAGTTGGCTTTGACCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-789s1c1
Sequence:CCGGCCATCTTGAAAGAGCTGCAGTCTCGAGACTGCAGCTCTTTCAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138371.1-547s1c1
Sequence:CCGGCTCTGTGCATAGGGCAGTATACTCGAGTATACTGCCCTATGCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172293
VALIDATED
PCED1B MISSION shRNA Bacterial Glycerol Stock
PC-esterase domain containing 1B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-622s1c1
Sequence:CCGGCAGCTACTCCACAACAAGTTTCTCGAGAAACTTGTTGTGGAGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-621s1c1
Sequence:CCGGGCAGCTACTCCACAACAAGTTCTCGAGAACTTGTTGTGGAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172293.2-1585s1c1
Sequence:CCGGCCATTCCCACTCTATCCTCAACTCGAGTTGAGGATAGAGTGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-1208s1c1
Sequence:CCGGCGGAAGCAACAAAGCACTATTCTCGAGAATAGTGCTTTGTTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172293.2-2014s1c1
Sequence:CCGGCTTGGACTTCTCTTTGTTTATCTCGAGATAAACAAAGAGAAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-1594s1c1
Sequence:CCGGCTCTATCCTCAAGTTTCCTATCTCGAGATAGGAAACTTGAGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172293
VALIDATED
PCED1B MISSION shRNA shRNA Plasmid DNA
PC-esterase domain containing 1B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-622s1c1
Sequence:CCGGCAGCTACTCCACAACAAGTTTCTCGAGAAACTTGTTGTGGAGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-621s1c1
Sequence:CCGGGCAGCTACTCCACAACAAGTTCTCGAGAACTTGTTGTGGAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172293.2-1585s1c1
Sequence:CCGGCCATTCCCACTCTATCCTCAACTCGAGTTGAGGATAGAGTGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-1208s1c1
Sequence:CCGGCGGAAGCAACAAAGCACTATTCTCGAGAATAGTGCTTTGTTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172293.2-2014s1c1
Sequence:CCGGCTTGGACTTCTCTTTGTTTATCTCGAGATAAACAAAGAGAAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-1594s1c1
Sequence:CCGGCTCTATCCTCAAGTTTCCTATCTCGAGATAGGAAACTTGAGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172293
VALIDATED
PCED1B MISSION shRNA Lentiviral Transduction Particles
PC-esterase domain containing 1B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-622s1c1
Sequence:CCGGCAGCTACTCCACAACAAGTTTCTCGAGAAACTTGTTGTGGAGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-621s1c1
Sequence:CCGGGCAGCTACTCCACAACAAGTTCTCGAGAACTTGTTGTGGAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172293.2-1585s1c1
Sequence:CCGGCCATTCCCACTCTATCCTCAACTCGAGTTGAGGATAGAGTGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172293.2-1208s1c1
Sequence:CCGGCGGAAGCAACAAAGCACTATTCTCGAGAATAGTGCTTTGTTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172293.2-2014s1c1
Sequence:CCGGCTTGGACTTCTCTTTGTTTATCTCGAGATAAACAAAGAGAAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172293.2-1594s1c1
Sequence:CCGGCTCTATCCTCAAGTTTCCTATCTCGAGATAGGAAACTTGAGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks