EMAIL THIS PAGE TO A FRIEND

PCGF6

polycomb group ring finger 6

Synonyms: MBLR RNF134
UniProtKB ID: Q9BYE7, A8K3R4, Q5SYD1, Q5SYD6, Q96ID9, Q96SJ1
Gene ID:
Human(84108) Summary: The protein encoded by this gene contains a RING finger motif, which is most closely related to those of polycomb group (PcG) proteins RNF110/MEL-18 and BMI1. PcG proteins are known to form protein complexes and function as transcription repressors. This protein has been shown to interact with some PcG proteins and act as a transcription repressor. The activity of this protein is found to be regulated by cell cycle dependent phosphorylation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(71041) polycomb group ring finger 6
Rat(309457) polycomb group ring finger 6
Zebrafish(555238) polycomb group ring finger 6
chicken(770712) polycomb group ring finger 6
dog(609633) polycomb group ring finger 6
domestic cat(101087872) polycomb group ring finger 6
cow(507739) polycomb group ring finger 6
sheep(101110553) polycomb group ring finger 6
naked mole-rat(101718547) polycomb group ring finger 6
domestic guinea pig(100722563) polycomb group ring finger 6
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011663 Rosetta Predictions human pricing
NM_032154 Rosetta Predictions human pricing
NM_001013154 Rosetta Predictions rat pricing
NM_027654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146632 predicted 1197
2 SASI_Hs01_00146633 predicted 1255
3 SASI_Hs01_00146634 predicted 1293
4 SASI_Hs01_00146635 predicted 1242
5 SASI_Hs01_00146636 predicted 1196
6 SASI_Hs01_00146637 predicted 1185
7 SASI_Hs01_00146638 predicted 1546
8 SASI_Hs01_00146640 predicted 1055
9 SASI_Hs01_00146641 predicted 1249
10 SASI_Hs02_00306008 predicted 1451
11 SASI_Hs01_00146639 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188231 predicted 974
2 SASI_Hs01_00188232 predicted 1030
3 SASI_Hs01_00188233 predicted 1067
4 SASI_Hs01_00188234 predicted 1022
5 SASI_Hs01_00188235 predicted 971
6 SASI_Hs01_00188236 predicted 957
7 SASI_Hs01_00188237 predicted 1319
8 SASI_Hs01_00188239 predicted 832
9 SASI_Hs01_00188240 predicted 1021
10 SASI_Hs02_00359392 predicted 1218
11 SASI_Hs01_00188238 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110384 predicted 1188
2 SASI_Rn01_00110385 predicted 635
3 SASI_Rn01_00110386 predicted 1015
4 SASI_Rn01_00110387 predicted 620
5 SASI_Rn01_00110388 predicted 1050
6 SASI_Rn01_00110389 predicted 873
7 SASI_Rn01_00110391 predicted 997
8 SASI_Rn01_00110392 predicted 562
9 SASI_Rn01_00110393 predicted 829
10 SASI_Rn02_00200883 predicted 631
11 SASI_Rn01_00110390 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029420 predicted 978
2 SASI_Mm01_00029421 predicted 602
3 SASI_Mm01_00029422 predicted 757
4 SASI_Mm01_00029423 predicted 858
5 SASI_Mm02_00332531 predicted 774
6 SASI_Mm01_00029424 predicted 1143
7 SASI_Mm01_00029425 predicted 617
8 SASI_Mm01_00029426 predicted 541
9 SASI_Mm01_00029428 predicted 1037
10 SASI_Mm01_00029429 predicted 935
11 SASI_Mm01_00029427 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027654
VALIDATED
PCGF6 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027654.2-1166s21c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-423s21c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-780s21c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-600s21c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-1166s1c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-423s1c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-780s1c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-600s1c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027654.1-456s1c1
Sequence:CCGGCTGATAGATGCAACCACCATTCTCGAGAATGGTGGTTGCATCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027654
VALIDATED
PCGF6 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027654.2-1166s21c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-423s21c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-780s21c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-600s21c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-1166s1c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-423s1c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-780s1c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-600s1c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027654.1-456s1c1
Sequence:CCGGCTGATAGATGCAACCACCATTCTCGAGAATGGTGGTTGCATCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027654
VALIDATED
PCGF6 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027654.2-1166s21c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-423s21c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-780s21c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027654.2-600s21c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-1166s1c1
Sequence:CCGGGCACGTAACTACGACTACTTTCTCGAGAAAGTAGTCGTAGTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-423s1c1
Sequence:CCGGCCCTACATCCTGTGTTCGATTCTCGAGAATCGAACACAGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-780s1c1
Sequence:CCGGCCTGAACTTGATATGTCTTTACTCGAGTAAAGACATATCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027654.1-600s1c1
Sequence:CCGGCGGCAGTTACAAGACATAGTACTCGAGTACTATGTCTTGTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027654.1-456s1c1
Sequence:CCGGCTGATAGATGCAACCACCATTCTCGAGAATGGTGGTTGCATCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032154
VALIDATED
PCGF6 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-472s21c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032154.3-1025s21c1
Sequence:CCGGCCAAGAATTATAGCGTTTATACTCGAGTATAAACGCTATAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-629s21c1
Sequence:CCGGTAATGAAGGCACGGGACATTTCTCGAGAAATGTCCCGTGCCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-420s21c1
Sequence:CCGGGAGGAGGAGCGCCTGATTAATCTCGAGATTAATCAGGCGCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-1022s1c1
Sequence:CCGGGCACCAAGAATTATAGCGTTTCTCGAGAAACGCTATAATTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-455s1c1
Sequence:CCGGCCCATACATCTTGTGTTCCATCTCGAGATGGAACACAAGATGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-785s1c1
Sequence:CCGGGCAGTATCAAACTCTAAGGGACTCGAGTCCCTTAGAGTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-472s1c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-771s1c1
Sequence:CCGGGATCACCTGTTGGAGCAGTATCTCGAGATACTGCTCCAACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032154
VALIDATED
PCGF6 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-472s21c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032154.3-1025s21c1
Sequence:CCGGCCAAGAATTATAGCGTTTATACTCGAGTATAAACGCTATAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-629s21c1
Sequence:CCGGTAATGAAGGCACGGGACATTTCTCGAGAAATGTCCCGTGCCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-420s21c1
Sequence:CCGGGAGGAGGAGCGCCTGATTAATCTCGAGATTAATCAGGCGCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-1022s1c1
Sequence:CCGGGCACCAAGAATTATAGCGTTTCTCGAGAAACGCTATAATTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-455s1c1
Sequence:CCGGCCCATACATCTTGTGTTCCATCTCGAGATGGAACACAAGATGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-785s1c1
Sequence:CCGGGCAGTATCAAACTCTAAGGGACTCGAGTCCCTTAGAGTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-472s1c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-771s1c1
Sequence:CCGGGATCACCTGTTGGAGCAGTATCTCGAGATACTGCTCCAACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032154
VALIDATED
PCGF6 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-472s21c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032154.3-1025s21c1
Sequence:CCGGCCAAGAATTATAGCGTTTATACTCGAGTATAAACGCTATAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-629s21c1
Sequence:CCGGTAATGAAGGCACGGGACATTTCTCGAGAAATGTCCCGTGCCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032154.3-420s21c1
Sequence:CCGGGAGGAGGAGCGCCTGATTAATCTCGAGATTAATCAGGCGCTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-1022s1c1
Sequence:CCGGGCACCAAGAATTATAGCGTTTCTCGAGAAACGCTATAATTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-455s1c1
Sequence:CCGGCCCATACATCTTGTGTTCCATCTCGAGATGGAACACAAGATGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-785s1c1
Sequence:CCGGGCAGTATCAAACTCTAAGGGACTCGAGTCCCTTAGAGTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-472s1c1
Sequence:CCGGCCATTTGCAAAGGTTACTTAACTCGAGTTAAGTAACCTTTGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_032154.3-771s1c1
Sequence:CCGGGATCACCTGTTGGAGCAGTATCTCGAGATACTGCTCCAACAGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks