EMAIL THIS PAGE TO A FRIEND

PCNA

proliferating cell nuclear antigen

UniProtKB ID: P12004, B2R897, D3DW02
Gene ID:
Human(5111) Summary: The protein encoded by this gene is found in the nucleus and is a cofactor of DNA polymerase delta. The encoded protein acts as a homotrimer and helps increase the processivity of leading strand synthesis during DNA replication. In response to DNA damage, this protein is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. Two transcript variants encoding the same protein have been found for this gene. Pseudogenes of this gene have been described on chromosome 4 and on the X chromosome. [provided by RefSeq, Jul 2008]
Mouse(18538) proliferating cell nuclear antigen
Rat(25737) proliferating cell nuclear antigen
Zebrafish(30678) proliferating cell nuclear antigen
domestic cat(101080704) proliferating cell nuclear antigen
dog(477166) proliferating cell nuclear antigen
chicken(373984) proliferating cell nuclear antigen
naked mole-rat(101714005) proliferating cell nuclear antigen
domestic guinea pig(100713865) proliferating cell nuclear antigen
cow(515499) proliferating cell nuclear antigen
sheep(443155) proliferating cell nuclear antigen
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108448 Anti-PCNA IgG fraction of antiserum canine, zebrafish, mouse, bovine, rat, human
immunohistochemistry, western blot pricing
SAB2502098 Anti-PCNA antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, pig, rat, canine, bovine
ELISA, western blot pricing
SAB2502099 Anti-PCNA antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig, bovine, rat, human, canine
ELISA, western blot pricing
SAB2701819 Anti-pcna antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV03018 Anti-PCNA antibody produced in rabbit IgG fraction of antiserum mouse, zebrafish, bovine, rat, human, canine
immunohistochemistry, western blot pricing
HPA030521 Anti-PCNA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA030522 Anti-PCNA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA030523 Anti-PCNA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human
immunohistochemistry, western blot pricing
SAB4502103 Anti-PCNA antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
WH0005111M2 Monoclonal Anti-PCNA antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404178 Monoclonal Anti-PCNA antibody produced in mouse clone S1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100556 Monoclonal Anti-PCNA antibody produced in mouse clone PCNA -A509, culture supernatant human
western blot pricing
P8825 Monoclonal Anti-Proliferating Cell Nuclear Antigen antibody produced in mouse clone PC 10, ascites fluid human, insect, monkey, yeast
rat, mouse
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
PLA0079 Rabbit anti-PCNA Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, rabbit, bovine, guinea pig, dog, rat, chicken, pig, turkey, mouse, horse
flow cytometry, immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0080 Rabbit anti-PCNA Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, guinea pig, gorilla, mouse, bovine, pig, rabbit, rat, dog, rhesus monkey, sheep, primate
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-2162 Anti-PCNA Antibody 100 µg, Use Anti-PCNA Antibody (Rabbit Polyclonal Antibody) validated in WB, ICC to detect PCNA also known as proliferating cell nuclear antigen, cyclin, DNA polymerase delta auxiliary protein, Cyclin. pricing
MAB4078 Anti-PCNA Antibody, clone 131-11912 100 µL, Anti-PCNA Antibody, clone 131-11912 is a mouse monoclonal antibody for detection of PCNA also known as Proliferating Cell Nuclear Antigen, DNA Polymerase delta Processivity Factor & has been validated in IF, ICC,IHC(P). pricing
05-347 Anti-PCNA Antibody, clone PC10 100 µg, Detect PCNA with Anti-PCNA Antibody, clone PC10 (Mouse Monoclonal Antibody), that has been shown to work in WB, ICC & IHC. pricing
CBL407 Anti-PCNA Antibody, clone PC10 100 µg, Anti-PCNA Antibody, clone PC10 is a mouse monoclonal antibody for detection of PCNA also known as Proliferating Cell Nuclear Antigen, DNA Polymerase delta Processivity Factor & has been validated in ELISA, FC, IP, WB,IHC(P). pricing
MAB424 Anti-PCNA Antibody, clone PC10 500 µg, Use Anti-PCNA Antibody, clone PC10 (mouse monoclonal antibody) validated in ELISA, FC,IHC(P), IP, WB to detect PCNA also known as Proliferating Cell Nuclear Antigen, DNA Polymerase delta Processivity Factor. pricing
MAB424R Anti-PCNA Antibody, clone PC10 100 µg, Anti-PCNA Antibody, clone PC10 is a mouse monoclonal antibody for detection of PCNA also known as Proliferating Cell Nuclear Antigen, DNA Polymerase delta Processivity Factor & has been validated in FC, IP, WB,IHC(P). pricing
MABE288 Anti-PCNA Antibody, clone PC10 200 µg, Use Anti-PCNA Antibody, clone PC10 (Mouse Monoclonal Antibody) validated in WB, IHC, IF to detect PCNA also known as Proliferating cell nuclear antigen, PCNA, Cyclin. pricing
CBL407F Anti-PCNA Antibody, clone PC10, FITC conjugated 100 assays, Use Anti-PCNA Antibody, clone PC10, FITC conjugated (mouse monoclonal antibody) validated in FC to detect PCNA also known as Proliferating Cell Nuclear Antigen, DNA Polymerase delta Processivity Factor. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002592 siRNAs that have been validated in the lab human pricing
NM_182649 siRNAs that have been validated in the lab human pricing
NM_022381 Rosetta Predictions rat pricing
NM_011045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002592 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174440 validated 689
2 SASI_Hs01_00174439 predicted 817
3 SASI_Hs01_00174441 predicted 956
4 SASI_Hs01_00174442 predicted 632
5 SASI_Hs01_00174443 predicted 565
6 SASI_Hs01_00174444 predicted 831
7 SASI_Hs01_00174445 predicted 569
8 SASI_Hs01_00174446 predicted 788
9 SASI_Hs01_00174448 predicted 671
10 SASI_Hs02_00334095 predicted 693
11 SASI_Hs01_00174447 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182649 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214948 validated 651
2 SASI_Hs01_00214947 predicted 782
3 SASI_Hs01_00214949 predicted 918
4 SASI_Hs01_00214950 predicted 596
5 SASI_Hs01_00214951 predicted 529
6 SASI_Hs01_00214952 predicted 792
7 SASI_Hs01_00214953 predicted 525
8 SASI_Hs01_00214954 predicted 748
9 SASI_Hs01_00214956 predicted 635
10 SASI_Hs02_00370810 predicted 651
11 SASI_Hs01_00214955 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059494 predicted 610
2 SASI_Rn01_00059495 predicted 635
3 SASI_Rn02_00263141 predicted 714
4 SASI_Rn01_00059497 predicted 605
5 SASI_Rn02_00263142 predicted 454
6 SASI_Rn01_00059499 predicted 595
7 SASI_Rn01_00059500 predicted 302
8 SASI_Rn01_00059501 predicted 657
9 SASI_Rn01_00059502 predicted 584
10 SASI_Rn01_00059503 predicted 733
11 SASI_Rn01_00059496 predicted 278
12 SASI_Rn01_00059498 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079334 predicted 735
2 SASI_Mm01_00079336 predicted 532
3 SASI_Mm01_00079337 predicted 610
4 SASI_Mm02_00319796 predicted 467
5 SASI_Mm01_00079338 predicted 672
6 SASI_Mm01_00079339 predicted 679
7 SASI_Mm01_00079340 predicted 598
8 SASI_Mm01_00079341 predicted 500
9 SASI_Mm01_00079342 predicted 482
10 SASI_Mm01_00079343 predicted 697
11 SASI_Mm01_00079335 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002592
VALIDATED
PCNA MISSION shRNA Bacterial Glycerol Stock
proliferating cell nuclear antigen
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-526s21c1
Sequence:CCGGCGGATACCTTGGCGCTAGTATCTCGAGATACTAGCGCCAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-836s21c1
Sequence:CCGGGAATGAACCAGTTCAACTAACCTCGAGGTTAGTTGAACTGGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-906s21c1
Sequence:CCGGTCAACGGTGACACTCAGTATGCTCGAGCATACTGAGTGTCACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-326s21c1
Sequence:CCGGTATTAGCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-673s1c1
Sequence:CCGGCACGTATATGCCGAGATCTCACTCGAGTGAGATCTCGGCATATACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-548s1c1
Sequence:CCGGTGAAGCACCAAACCAGGAGAACTCGAGTTCTCCTGGTTTGGTGCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-705s1c1
Sequence:CCGGGATGCTGTTGTAATTTCCTGTCTCGAGACAGGAAATTACAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-549s1c1
Sequence:CCGGGAAGCACCAAACCAGGAGAAACTCGAGTTTCTCCTGGTTTGGTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-370s1c1
Sequence:CCGGACGTCTCTTTGGTGCAGCTCACTCGAGTGAGCTGCACCAAAGAGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002592
VALIDATED
PCNA MISSION shRNA shRNA Plasmid DNA
proliferating cell nuclear antigen
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-526s21c1
Sequence:CCGGCGGATACCTTGGCGCTAGTATCTCGAGATACTAGCGCCAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-836s21c1
Sequence:CCGGGAATGAACCAGTTCAACTAACCTCGAGGTTAGTTGAACTGGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-906s21c1
Sequence:CCGGTCAACGGTGACACTCAGTATGCTCGAGCATACTGAGTGTCACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-326s21c1
Sequence:CCGGTATTAGCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-673s1c1
Sequence:CCGGCACGTATATGCCGAGATCTCACTCGAGTGAGATCTCGGCATATACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-548s1c1
Sequence:CCGGTGAAGCACCAAACCAGGAGAACTCGAGTTCTCCTGGTTTGGTGCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-705s1c1
Sequence:CCGGGATGCTGTTGTAATTTCCTGTCTCGAGACAGGAAATTACAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-549s1c1
Sequence:CCGGGAAGCACCAAACCAGGAGAAACTCGAGTTTCTCCTGGTTTGGTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-370s1c1
Sequence:CCGGACGTCTCTTTGGTGCAGCTCACTCGAGTGAGCTGCACCAAAGAGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002592
VALIDATED
PCNA MISSION shRNA Lentiviral Transduction Particles
proliferating cell nuclear antigen
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-526s21c1
Sequence:CCGGCGGATACCTTGGCGCTAGTATCTCGAGATACTAGCGCCAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-836s21c1
Sequence:CCGGGAATGAACCAGTTCAACTAACCTCGAGGTTAGTTGAACTGGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-906s21c1
Sequence:CCGGTCAACGGTGACACTCAGTATGCTCGAGCATACTGAGTGTCACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002592.2-326s21c1
Sequence:CCGGTATTAGCTCCAGCGGTGTAAACTCGAGTTTACACCGCTGGAGCTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-673s1c1
Sequence:CCGGCACGTATATGCCGAGATCTCACTCGAGTGAGATCTCGGCATATACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-548s1c1
Sequence:CCGGTGAAGCACCAAACCAGGAGAACTCGAGTTCTCCTGGTTTGGTGCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-705s1c1
Sequence:CCGGGATGCTGTTGTAATTTCCTGTCTCGAGACAGGAAATTACAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002592.x-549s1c1
Sequence:CCGGGAAGCACCAAACCAGGAGAAACTCGAGTTTCTCCTGGTTTGGTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002592.x-370s1c1
Sequence:CCGGACGTCTCTTTGGTGCAGCTCACTCGAGTGAGCTGCACCAAAGAGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011045
VALIDATED
PCNA MISSION shRNA Bacterial Glycerol Stock
proliferating cell nuclear antigen
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-1010s21c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-304s21c1
Sequence:CCGGTCCGAAGGCTTCGACACATACCTCGAGGTATGTGTCGAAGCCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-481s21c1
Sequence:CCGGGACTATGAAATGAAGTTAATGCTCGAGCATTAACTTCATTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-536s21c1
Sequence:CCGGAGGAGTACAGCTGTGTAATAACTCGAGTTATTACACAGCTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-665s21c1
Sequence:CCGGAGCTTGGCAATGGGAACATTACTCGAGTAATGTTCCCATTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011045.1-1010s1c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-566s1c1
Sequence:CCGGCGGGTGAATTTGCACGTATATCTCGAGATATACGTGCAAATTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-453s1c1
Sequence:CCGGCGAAGCACCAAATCAAGAGAACTCGAGTTCTCTTGATTTGGTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011045.1-873s1c1
Sequence:CCGGCATGGGACACTTAAAGTATTACTCGAGTAATACTTTAAGTGTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-724s1c1
Sequence:CCGGGCGGTAACCATAGAGATGAATCTCGAGATTCATCTCTATGGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011045
VALIDATED
PCNA MISSION shRNA shRNA Plasmid DNA
proliferating cell nuclear antigen
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-1010s21c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-304s21c1
Sequence:CCGGTCCGAAGGCTTCGACACATACCTCGAGGTATGTGTCGAAGCCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-481s21c1
Sequence:CCGGGACTATGAAATGAAGTTAATGCTCGAGCATTAACTTCATTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-536s21c1
Sequence:CCGGAGGAGTACAGCTGTGTAATAACTCGAGTTATTACACAGCTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-665s21c1
Sequence:CCGGAGCTTGGCAATGGGAACATTACTCGAGTAATGTTCCCATTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011045.1-1010s1c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-566s1c1
Sequence:CCGGCGGGTGAATTTGCACGTATATCTCGAGATATACGTGCAAATTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-453s1c1
Sequence:CCGGCGAAGCACCAAATCAAGAGAACTCGAGTTCTCTTGATTTGGTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011045.1-873s1c1
Sequence:CCGGCATGGGACACTTAAAGTATTACTCGAGTAATACTTTAAGTGTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-724s1c1
Sequence:CCGGGCGGTAACCATAGAGATGAATCTCGAGATTCATCTCTATGGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011045
VALIDATED
PCNA MISSION shRNA Lentiviral Transduction Particles
proliferating cell nuclear antigen
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-1010s21c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-304s21c1
Sequence:CCGGTCCGAAGGCTTCGACACATACCTCGAGGTATGTGTCGAAGCCTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-481s21c1
Sequence:CCGGGACTATGAAATGAAGTTAATGCTCGAGCATTAACTTCATTTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-536s21c1
Sequence:CCGGAGGAGTACAGCTGTGTAATAACTCGAGTTATTACACAGCTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011045.2-665s21c1
Sequence:CCGGAGCTTGGCAATGGGAACATTACTCGAGTAATGTTCCCATTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011045.1-1010s1c1
Sequence:CCGGCCAAGTTTGTACCTGAGTATTCTCGAGAATACTCAGGTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-566s1c1
Sequence:CCGGCGGGTGAATTTGCACGTATATCTCGAGATATACGTGCAAATTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-453s1c1
Sequence:CCGGCGAAGCACCAAATCAAGAGAACTCGAGTTCTCTTGATTTGGTGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011045.1-873s1c1
Sequence:CCGGCATGGGACACTTAAAGTATTACTCGAGTAATACTTTAAGTGTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011045.1-724s1c1
Sequence:CCGGGCGGTAACCATAGAGATGAATCTCGAGATTCATCTCTATGGTTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks