EMAIL THIS PAGE TO A FRIEND

PCNXL2

pecanex-like 2 (Drosophila)

Gene ID:
Mouse(270109) pecanex-like 2 (Drosophila)
Rat(307949) pecanex-like 2 (Drosophila)
Zebrafish(561583) pecanex-like 2 (Drosophila)
dog(488967) pecanex-like 2 (Drosophila)
domestic cat(101088693) pecanex-like 2 (Drosophila)
Horse(100051097) pecanex-like 2 (Drosophila)
chicken(428587) pecanex-like 2 (Drosophila)
cow(528971) pecanex-like 2 (Drosophila)
sheep(101115180) pecanex-like 2 (Drosophila)
naked mole-rat(101705803) pecanex-like 2 (Drosophila)
Domestic Rabbit(100346903) pecanex-like 2 (Drosophila)
domestic guinea pig(100735481) pecanex-like 2 (Drosophila)
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039231 MISSION® esiRNA esiRNA human PCNXL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014801 Rosetta Predictions human pricing
NM_024938 Rosetta Predictions human pricing
XM_001055579 Rosetta Predictions rat pricing
XM_226571 Rosetta Predictions rat pricing
NM_172917 Rosetta Predictions mouse pricing
NM_175561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346308 predicted 3749
2 SASI_Hs01_00228532 predicted 2750
3 SASI_Hs01_00228533 predicted 1281
4 SASI_Hs02_00346309 predicted 3743
5 SASI_Hs02_00346310 predicted 4819
6 SASI_Hs02_00346311 predicted 3492
7 SASI_Hs02_00346312 predicted 2945
8 SASI_Hs02_00346313 predicted 4926
9 SASI_Hs01_00228537 predicted 1947
10 SASI_Hs02_00346314 predicted 3815
11 SASI_Hs01_00228534 predicted 880
12 SASI_Hs01_00228535 predicted 1041
13 SASI_Hs01_00228536 predicted 827
14 SASI_Hs01_00228538 predicted 1185
15 SASI_Hs01_00228539 predicted 635
16 SASI_Hs01_00228540 predicted 979
17 SASI_Hs01_00228541 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045279 predicted 1856
2 SASI_Hs01_00045280 predicted 530
3 SASI_Hs01_00045281 predicted 883
4 SASI_Hs01_00045282 predicted 1034
5 SASI_Hs01_00045283 predicted 830
6 SASI_Hs01_00045284 predicted 1209
7 SASI_Hs01_00045285 predicted 1182
8 SASI_Hs01_00045286 predicted 633
9 SASI_Hs01_00045287 predicted 976
10 SASI_Hs01_00045288 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280162 predicted 1020
2 SASI_Rn02_00280163 predicted 1498
3 SASI_Rn02_00280164 predicted 3701
4 SASI_Rn02_00280165 predicted 1918
5 SASI_Rn02_00280166 predicted 1327
6 SASI_Rn02_00280167 predicted 4419
7 SASI_Rn02_00280168 predicted 6365
8 SASI_Rn02_00280169 predicted 4777
9 SASI_Rn02_00280170 predicted 5248
10 SASI_Rn02_00280171 predicted 3776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383675 predicted 343
2 SASI_Rn02_00383676 predicted 798
3 SASI_Rn02_00383677 predicted 435
4 SASI_Rn02_00383678 predicted 1240
5 SASI_Rn02_00383679 predicted 994
6 SASI_Rn02_00383680 predicted 797
7 SASI_Rn02_00383681 predicted 1341
8 SASI_Rn02_00383682 predicted 1259
9 SASI_Rn02_00383683 predicted 883
10 SASI_Rn02_00383684 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108470 predicted 1272
2 SASI_Mm01_00108471 predicted 958
3 SASI_Mm01_00108472 predicted 2144
4 SASI_Mm01_00108473 predicted 2259
5 SASI_Mm01_00108474 predicted 2450
6 SASI_Mm01_00108475 predicted 1754
7 SASI_Mm01_00108476 predicted 251
8 SASI_Mm01_00108477 predicted 2251
9 SASI_Mm01_00108478 predicted 1923
10 SASI_Mm01_00108479 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346535 predicted 1883
2 SASI_Mm01_00192899 predicted 3675
3 SASI_Mm02_00346536 predicted 1574
4 SASI_Mm02_00346537 predicted 2748
5 SASI_Mm02_00346538 predicted 2868
6 SASI_Mm02_00346539 predicted 3058
7 SASI_Mm02_00346540 predicted 2359
8 SASI_Mm02_00346541 predicted 2858
9 SASI_Mm02_00346542 predicted 2531
10 SASI_Mm02_00346543 predicted 4382
11 SASI_Mm01_00192897 predicted 2701
12 SASI_Mm01_00192898 predicted 1150
13 SASI_Mm01_00192900 predicted 2132
14 SASI_Mm01_00192901 predicted 3229
15 SASI_Mm01_00192902 predicted 633
16 SASI_Mm01_00192903 predicted 1177
17 SASI_Mm01_00192904 predicted 1096
18 SASI_Mm01_00192905 predicted 3445
19 SASI_Mm01_00192906 predicted 3016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014801
VALIDATED
PCNXL2 MISSION shRNA Bacterial Glycerol Stock
pecanex-like 2 (Drosophila)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-3951s21c1
Sequence:CCGGGCAACCCGGTTTACCAGTTTACTCGAGTAAACTGGTAAACCGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-1976s21c1
Sequence:CCGGTCCCTGTTAGAATCCATTAATCTCGAGATTAATGGATTCTAACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-2493s21c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-2947s21c1
Sequence:CCGGATATAGCAGACCAATCTATTTCTCGAGAAATAGATTGGTCTGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-3815s21c1
Sequence:CCGGATCTTGTACCCAGCGCTAATTCTCGAGAATTAGCGCTGGGTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1743s1c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014801.2-918s1c1
Sequence:CCGGCCATCAAGGATCACAGTTCTTCTCGAGAAGAACTGTGATCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-685s1c1
Sequence:CCGGCACAGAGAAGACCAGTGTAAACTCGAGTTTACACTGGTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-634s1c1
Sequence:CCGGCCCAAACTCCATGACAGATTTCTCGAGAAATCTGTCATGGAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014801.2-3438s1c1
Sequence:CCGGCCAGGGAATGATGACAACAATCTCGAGATTGTTGTCATCATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1024s1c1
Sequence:CCGGCCTTGACCCATCGTCTTGTAACTCGAGTTACAAGACGATGGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-256s1c1
Sequence:CCGGCCACCTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-1316s1c1
Sequence:CCGGCGAGATAACTGTTCCCAGGAACTCGAGTTCCTGGGAACAGTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014801
VALIDATED
PCNXL2 MISSION shRNA shRNA Plasmid DNA
pecanex-like 2 (Drosophila)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-3951s21c1
Sequence:CCGGGCAACCCGGTTTACCAGTTTACTCGAGTAAACTGGTAAACCGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-1976s21c1
Sequence:CCGGTCCCTGTTAGAATCCATTAATCTCGAGATTAATGGATTCTAACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-2493s21c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-2947s21c1
Sequence:CCGGATATAGCAGACCAATCTATTTCTCGAGAAATAGATTGGTCTGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-3815s21c1
Sequence:CCGGATCTTGTACCCAGCGCTAATTCTCGAGAATTAGCGCTGGGTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1743s1c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014801.2-918s1c1
Sequence:CCGGCCATCAAGGATCACAGTTCTTCTCGAGAAGAACTGTGATCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-685s1c1
Sequence:CCGGCACAGAGAAGACCAGTGTAAACTCGAGTTTACACTGGTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-634s1c1
Sequence:CCGGCCCAAACTCCATGACAGATTTCTCGAGAAATCTGTCATGGAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014801.2-3438s1c1
Sequence:CCGGCCAGGGAATGATGACAACAATCTCGAGATTGTTGTCATCATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1024s1c1
Sequence:CCGGCCTTGACCCATCGTCTTGTAACTCGAGTTACAAGACGATGGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-256s1c1
Sequence:CCGGCCACCTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-1316s1c1
Sequence:CCGGCGAGATAACTGTTCCCAGGAACTCGAGTTCCTGGGAACAGTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014801
VALIDATED
PCNXL2 MISSION shRNA Lentiviral Transduction Particles
pecanex-like 2 (Drosophila)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-3951s21c1
Sequence:CCGGGCAACCCGGTTTACCAGTTTACTCGAGTAAACTGGTAAACCGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-1976s21c1
Sequence:CCGGTCCCTGTTAGAATCCATTAATCTCGAGATTAATGGATTCTAACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014801.3-2493s21c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-2947s21c1
Sequence:CCGGATATAGCAGACCAATCTATTTCTCGAGAAATAGATTGGTCTGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014801.3-3815s21c1
Sequence:CCGGATCTTGTACCCAGCGCTAATTCTCGAGAATTAGCGCTGGGTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1743s1c1
Sequence:CCGGCTGAGAGTCAAGATCCGTCTTCTCGAGAAGACGGATCTTGACTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014801.2-918s1c1
Sequence:CCGGCCATCAAGGATCACAGTTCTTCTCGAGAAGAACTGTGATCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-685s1c1
Sequence:CCGGCACAGAGAAGACCAGTGTAAACTCGAGTTTACACTGGTCTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-634s1c1
Sequence:CCGGCCCAAACTCCATGACAGATTTCTCGAGAAATCTGTCATGGAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014801.2-3438s1c1
Sequence:CCGGCCAGGGAATGATGACAACAATCTCGAGATTGTTGTCATCATTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014801.2-1024s1c1
Sequence:CCGGCCTTGACCCATCGTCTTGTAACTCGAGTTACAAGACGATGGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-256s1c1
Sequence:CCGGCCACCTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014801.2-1316s1c1
Sequence:CCGGCGAGATAACTGTTCCCAGGAACTCGAGTTCCTGGGAACAGTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175561
PCNXL2 MISSION shRNA Bacterial Glycerol Stock
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1619s1c1
Sequence:CCGGCTATAGCATCATCGATAACAACTCGAGTTGTTATCGATGATGCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1177s1c1
Sequence:CCGGGCATGGATAATTCCAACACAACTCGAGTTGTGTTGGAATTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1148s1c1
Sequence:CCGGGTTCTGGGAGAGAAGCTATAACTCGAGTTATAGCTTCTCTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1748s1c1
Sequence:CCGGCAAGAATGAATCCCTGCTGAACTCGAGTTCAGCAGGGATTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175561.2-3800s1c1
Sequence:CCGGGCTGGTTAAATTAGAACAGCTCTCGAGAGCTGTTCTAATTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175561
PCNXL2 MISSION shRNA shRNA Plasmid DNA
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1619s1c1
Sequence:CCGGCTATAGCATCATCGATAACAACTCGAGTTGTTATCGATGATGCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1177s1c1
Sequence:CCGGGCATGGATAATTCCAACACAACTCGAGTTGTGTTGGAATTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1148s1c1
Sequence:CCGGGTTCTGGGAGAGAAGCTATAACTCGAGTTATAGCTTCTCTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1748s1c1
Sequence:CCGGCAAGAATGAATCCCTGCTGAACTCGAGTTCAGCAGGGATTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175561.2-3800s1c1
Sequence:CCGGGCTGGTTAAATTAGAACAGCTCTCGAGAGCTGTTCTAATTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175561
PCNXL2 MISSION shRNA Lentiviral Transduction Particles
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1619s1c1
Sequence:CCGGCTATAGCATCATCGATAACAACTCGAGTTGTTATCGATGATGCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1177s1c1
Sequence:CCGGGCATGGATAATTCCAACACAACTCGAGTTGTGTTGGAATTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175561.2-1148s1c1
Sequence:CCGGGTTCTGGGAGAGAAGCTATAACTCGAGTTATAGCTTCTCTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175561.2-1748s1c1
Sequence:CCGGCAAGAATGAATCCCTGCTGAACTCGAGTTCAGCAGGGATTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175561.2-3800s1c1
Sequence:CCGGGCTGGTTAAATTAGAACAGCTCTCGAGAGCTGTTCTAATTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172917
PCNXL2 MISSION shRNA Bacterial Glycerol Stock
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2258s1c1
Sequence:CCGGCAGACCCATCTATTTCTGTATCTCGAGATACAGAAATAGATGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172917.1-692s1c1
Sequence:CCGGCGAACCCATTAAGATAGTAATCTCGAGATTACTATCTTAATGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172917.1-2978s1c1
Sequence:CCGGCCCAGTCTGTAGATTATCTCTCTCGAGAGAGATAATCTACAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-245s1c1
Sequence:CCGGGCCAGTTACCACAGAACTCTTCTCGAGAAGAGTTCTGTGGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2387s1c1
Sequence:CCGGCAGGGACCACTTAATAGTATTCTCGAGAATACTATTAAGTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172917
PCNXL2 MISSION shRNA shRNA Plasmid DNA
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2258s1c1
Sequence:CCGGCAGACCCATCTATTTCTGTATCTCGAGATACAGAAATAGATGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172917.1-692s1c1
Sequence:CCGGCGAACCCATTAAGATAGTAATCTCGAGATTACTATCTTAATGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172917.1-2978s1c1
Sequence:CCGGCCCAGTCTGTAGATTATCTCTCTCGAGAGAGATAATCTACAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-245s1c1
Sequence:CCGGGCCAGTTACCACAGAACTCTTCTCGAGAAGAGTTCTGTGGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2387s1c1
Sequence:CCGGCAGGGACCACTTAATAGTATTCTCGAGAATACTATTAAGTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172917
PCNXL2 MISSION shRNA Lentiviral Transduction Particles
pecanex-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2258s1c1
Sequence:CCGGCAGACCCATCTATTTCTGTATCTCGAGATACAGAAATAGATGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172917.1-692s1c1
Sequence:CCGGCGAACCCATTAAGATAGTAATCTCGAGATTACTATCTTAATGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172917.1-2978s1c1
Sequence:CCGGCCCAGTCTGTAGATTATCTCTCTCGAGAGAGATAATCTACAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-245s1c1
Sequence:CCGGGCCAGTTACCACAGAACTCTTCTCGAGAAGAGTTCTGTGGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172917.1-2387s1c1
Sequence:CCGGCAGGGACCACTTAATAGTATTCTCGAGAATACTATTAAGTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks