EMAIL THIS PAGE TO A FRIEND

PCOLCE

procollagen C-endopeptidase enhancer

Synonyms: PCPE PCPE-1 PCPE1
UniProtKB ID: Q15113, B2R9E1, O14550
Gene ID:
Human(5118) Summary: Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
Mouse(18542) procollagen C-endopeptidase enhancer protein
Rat(29569) procollagen C-endopeptidase enhancer
domestic guinea pig(100713467) procollagen C-endopeptidase enhancer
naked mole-rat(101716440) procollagen C-endopeptidase enhancer
cow(504471) procollagen C-endopeptidase enhancer
sheep(101104033) procollagen C-endopeptidase enhancer
domestic cat(101091986) procollagen C-endopeptidase enhancer
Horse(100067418) procollagen C-endopeptidase enhancer
dog(489835) procollagen C-endopeptidase enhancer
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1627 Human PCPE-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002593 Rosetta Predictions human pricing
NM_019237 Rosetta Predictions rat pricing
NM_008788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079864 predicted 953
2 SASI_Hs02_00334096 predicted 372
3 SASI_Hs01_00079865 predicted 939
4 SASI_Hs01_00079866 predicted 1265
5 SASI_Hs01_00079867 predicted 1383
6 SASI_Hs01_00079868 predicted 709
7 SASI_Hs02_00334097 predicted 971
8 SASI_Hs01_00079870 predicted 1062
9 SASI_Hs01_00079871 predicted 586
10 SASI_Hs01_00079872 predicted 1092
11 SASI_Hs01_00079869 predicted 364
12 SASI_Hs01_00079873 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101354 predicted 794
2 SASI_Rn01_00101355 predicted 570
3 SASI_Rn01_00101356 predicted 632
4 SASI_Rn01_00101357 predicted 1250
5 SASI_Rn02_00262106 predicted 603
6 SASI_Rn02_00262107 predicted 819
7 SASI_Rn01_00101358 predicted 687
8 SASI_Rn01_00101359 predicted 1098
9 SASI_Rn02_00262108 predicted 698
10 SASI_Rn01_00101361 predicted 426
11 SASI_Rn01_00101353 predicted 475
12 SASI_Rn01_00101360 predicted 672
13 SASI_Rn01_00101362 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100214 predicted 708
2 SASI_Mm02_00314687 predicted 588
3 SASI_Mm01_00100217 predicted 644
4 SASI_Mm01_00100218 predicted 626
5 SASI_Mm01_00100219 predicted 998
6 SASI_Mm01_00100221 predicted 815
7 SASI_Mm01_00100222 predicted 694
8 SASI_Mm01_00100223 predicted 1119
9 SASI_Mm02_00314688 predicted 635
10 SASI_Mm02_00314689 predicted 447
11 SASI_Mm01_00100215 predicted 640
12 SASI_Mm01_00100216 predicted 553
13 SASI_Mm01_00100220 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002593
VALIDATED
PCOLCE MISSION shRNA Bacterial Glycerol Stock
procollagen C-endopeptidase enhancer
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-1262s1c1
Sequence:CCGGCCATGAAGAAAGGAGTCAGTTCTCGAGAACTGACTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-834s1c1
Sequence:CCGGGAATGAACTCCTCGTCCAGTTCTCGAGAACTGGACGAGGAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-794s21c1
Sequence:CCGGCGCTGACCTTCGAGAAGTTTGCTCGAGCAAACTTCTCGAAGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1260s21c1
Sequence:CCGGTGCCGTGACTGTCAGTCTTATCTCGAGATAAGACTGACAGTCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1373s21c1
Sequence:CCGGTGAAGAAAGGAGTCAGTTATCCTCGAGGATAACTGACTCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-380s21c1
Sequence:CCGGAGGAGTGCATCTGGACCATAACTCGAGTTATGGTCCAGATGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-652s21c1
Sequence:CCGGTCGGGCACTGAGCACCAATTTCTCGAGAAATTGGTGCTCAGTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002593
VALIDATED
PCOLCE MISSION shRNA shRNA Plasmid DNA
procollagen C-endopeptidase enhancer
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-1262s1c1
Sequence:CCGGCCATGAAGAAAGGAGTCAGTTCTCGAGAACTGACTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-834s1c1
Sequence:CCGGGAATGAACTCCTCGTCCAGTTCTCGAGAACTGGACGAGGAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-794s21c1
Sequence:CCGGCGCTGACCTTCGAGAAGTTTGCTCGAGCAAACTTCTCGAAGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1260s21c1
Sequence:CCGGTGCCGTGACTGTCAGTCTTATCTCGAGATAAGACTGACAGTCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1373s21c1
Sequence:CCGGTGAAGAAAGGAGTCAGTTATCCTCGAGGATAACTGACTCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-380s21c1
Sequence:CCGGAGGAGTGCATCTGGACCATAACTCGAGTTATGGTCCAGATGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-652s21c1
Sequence:CCGGTCGGGCACTGAGCACCAATTTCTCGAGAAATTGGTGCTCAGTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002593
VALIDATED
PCOLCE MISSION shRNA Lentiviral Transduction Particles
procollagen C-endopeptidase enhancer
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-1262s1c1
Sequence:CCGGCCATGAAGAAAGGAGTCAGTTCTCGAGAACTGACTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002593.2-834s1c1
Sequence:CCGGGAATGAACTCCTCGTCCAGTTCTCGAGAACTGGACGAGGAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-794s21c1
Sequence:CCGGCGCTGACCTTCGAGAAGTTTGCTCGAGCAAACTTCTCGAAGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1260s21c1
Sequence:CCGGTGCCGTGACTGTCAGTCTTATCTCGAGATAAGACTGACAGTCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-1373s21c1
Sequence:CCGGTGAAGAAAGGAGTCAGTTATCCTCGAGGATAACTGACTCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-380s21c1
Sequence:CCGGAGGAGTGCATCTGGACCATAACTCGAGTTATGGTCCAGATGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002593.3-652s21c1
Sequence:CCGGTCGGGCACTGAGCACCAATTTCTCGAGAAATTGGTGCTCAGTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008788
VALIDATED
PCOLCE MISSION shRNA Bacterial Glycerol Stock
procollagen C-endopeptidase enhancer
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008788.1-604s1c1
Sequence:CCGGGCACATCATTGCACCCTCAAACTCGAGTTTGAGGGTGCAATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1284s1c1
Sequence:CCGGCATGAAGAAAGGAGCCAGTTACTCGAGTAACTGGCTCCTTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1283s1c1
Sequence:CCGGCCATGAAGAAAGGAGCCAGTTCTCGAGAACTGGCTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-627s21c1
Sequence:CCGGGCTGTTCCTGGCACATCATTGCTCGAGCAATGATGTGCCAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-255s21c1
Sequence:CCGGAGAAGTGCATCTGGACAATTACTCGAGTAATTGTCCAGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-698s21c1
Sequence:CCGGCCTGACACGTACTGCCGATATCTCGAGATATCGGCAGTACGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-348s21c1
Sequence:CCGGACGATGCTCTGGAGGTCTTTGCTCGAGCAAAGACCTCCAGAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-592s21c1
Sequence:CCGGCAACTGGCCTGAGTCGGATTACTCGAGTAATCCGACTCAGGCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008788
VALIDATED
PCOLCE MISSION shRNA shRNA Plasmid DNA
procollagen C-endopeptidase enhancer
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008788.1-604s1c1
Sequence:CCGGGCACATCATTGCACCCTCAAACTCGAGTTTGAGGGTGCAATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1284s1c1
Sequence:CCGGCATGAAGAAAGGAGCCAGTTACTCGAGTAACTGGCTCCTTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1283s1c1
Sequence:CCGGCCATGAAGAAAGGAGCCAGTTCTCGAGAACTGGCTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-627s21c1
Sequence:CCGGGCTGTTCCTGGCACATCATTGCTCGAGCAATGATGTGCCAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-255s21c1
Sequence:CCGGAGAAGTGCATCTGGACAATTACTCGAGTAATTGTCCAGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-698s21c1
Sequence:CCGGCCTGACACGTACTGCCGATATCTCGAGATATCGGCAGTACGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-348s21c1
Sequence:CCGGACGATGCTCTGGAGGTCTTTGCTCGAGCAAAGACCTCCAGAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-592s21c1
Sequence:CCGGCAACTGGCCTGAGTCGGATTACTCGAGTAATCCGACTCAGGCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008788
VALIDATED
PCOLCE MISSION shRNA Lentiviral Transduction Particles
procollagen C-endopeptidase enhancer
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008788.1-604s1c1
Sequence:CCGGGCACATCATTGCACCCTCAAACTCGAGTTTGAGGGTGCAATGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1284s1c1
Sequence:CCGGCATGAAGAAAGGAGCCAGTTACTCGAGTAACTGGCTCCTTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008788.1-1283s1c1
Sequence:CCGGCCATGAAGAAAGGAGCCAGTTCTCGAGAACTGGCTCCTTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-627s21c1
Sequence:CCGGGCTGTTCCTGGCACATCATTGCTCGAGCAATGATGTGCCAGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-255s21c1
Sequence:CCGGAGAAGTGCATCTGGACAATTACTCGAGTAATTGTCCAGATGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-698s21c1
Sequence:CCGGCCTGACACGTACTGCCGATATCTCGAGATATCGGCAGTACGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-348s21c1
Sequence:CCGGACGATGCTCTGGAGGTCTTTGCTCGAGCAAAGACCTCCAGAGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008788.2-592s21c1
Sequence:CCGGCAACTGGCCTGAGTCGGATTACTCGAGTAATCCGACTCAGGCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks