EMAIL THIS PAGE TO A FRIEND

PCYT1B

phosphate cytidylyltransferase 1, choline, beta

Synonyms: CCTB CTB
Gene ID:
Human(9468) Summary: The protein encoded by this gene belongs to the cytidylyltransferase family. It is involved in the regulation of phosphatidylcholine biosynthesis. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(236899) phosphate cytidylyltransferase 1, choline, beta isoform
Rat(286936) phosphate cytidylyltransferase 1, choline, beta
chicken(418594) phosphate cytidylyltransferase 1, choline, beta
dog(491780) phosphate cytidylyltransferase 1, choline, beta
domestic cat(101095719) phosphate cytidylyltransferase 1, choline, beta
domestic guinea pig(100717352) phosphate cytidylyltransferase 1, choline, beta
naked mole-rat(101699942) phosphate cytidylyltransferase 1, choline, beta
Domestic Rabbit(100353056) phosphate cytidylyltransferase 1, choline, beta
cow(526175) phosphate cytidylyltransferase 1, choline, beta
sheep(101115344) phosphate cytidylyltransferase 1, choline, beta
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004845 Rosetta Predictions human pricing
NM_173151 Rosetta Predictions rat pricing
NM_177546 Rosetta Predictions mouse pricing
NM_211138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118368 predicted 886
2 SASI_Hs01_00118369 predicted 360
3 SASI_Hs01_00118370 predicted 637
4 SASI_Hs01_00118371 predicted 796
5 SASI_Hs01_00118372 predicted 520
6 SASI_Hs01_00118373 predicted 812
7 SASI_Hs01_00118375 predicted 467
8 SASI_Hs01_00118376 predicted 899
9 SASI_Hs01_00118377 predicted 727
10 SASI_Hs02_00338432 predicted 1306
11 SASI_Hs01_00118374 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269336 predicted 572
2 SASI_Rn02_00269337 predicted 623
3 SASI_Rn02_00269338 predicted 769
4 SASI_Rn02_00269339 predicted 697
5 SASI_Rn02_00269340 predicted 463
6 SASI_Rn02_00269341 predicted 516
7 SASI_Rn02_00269342 predicted 646
8 SASI_Rn02_00269343 predicted 348
9 SASI_Rn02_00269344 predicted 778
10 SASI_Rn02_00269345 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033796 predicted 802
2 SASI_Mm01_00033797 predicted 546
3 SASI_Mm02_00347698 predicted 856
4 SASI_Mm01_00033798 predicted 1037
5 SASI_Mm01_00033799 predicted 1014
6 SASI_Mm01_00033800 predicted 585
7 SASI_Mm01_00033801 predicted 682
8 SASI_Mm01_00033802 predicted 997
9 SASI_Mm01_00033803 predicted 625
10 SASI_Mm01_00033804 predicted 1008
11 SASI_Mm01_00033805 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_211138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161670 predicted 810
2 SASI_Mm02_00352250 predicted 868
3 SASI_Mm01_00161671 predicted 1056
4 SASI_Mm01_00161672 predicted 1028
5 SASI_Mm01_00161673 predicted 592
6 SASI_Mm01_00161674 predicted 697
7 SASI_Mm01_00161675 predicted 1009
8 SASI_Mm01_00161676 predicted 636
9 SASI_Mm01_00161677 predicted 1018
10 SASI_Mm01_00161678 predicted 587
11 SASI_Mm01_00161679 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004845
PCYT1B MISSION shRNA Bacterial Glycerol Stock
phosphate cytidylyltransferase 1, choline, beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004845.4-860s21c1
Sequence:CCGGTGTTCGTGACTATGATGTTTACTCGAGTAAACATCATAGTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1412s21c1
Sequence:CCGGGGTGGTGTTTGAAGGGTAATACTCGAGTATTACCCTTCAAACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1716s21c1
Sequence:CCGGTGCTACTTCTGCGTCCATAAGCTCGAGCTTATGGACGCAGAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-314s1c1
Sequence:CCGGCCCAACAGCTACTTGTTGGTACTCGAGTACCAACAAGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-689s1c1
Sequence:CCGGGAACTGAATGTCAGCTTTATACTCGAGTATAAAGCTGACATTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-813s1c1
Sequence:CCGGAGAGCCATGATCTAATTCAAACTCGAGTTTGAATTAGATCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-601s1c1
Sequence:CCGGCATCTCAACATCGGACATCATCTCGAGATGATGTCCGATGTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-503s1c1
Sequence:CCGGGCTCATGATGACATTCCGTATCTCGAGATACGGAATGTCATCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004845
PCYT1B MISSION shRNA shRNA Plasmid DNA
phosphate cytidylyltransferase 1, choline, beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004845.4-860s21c1
Sequence:CCGGTGTTCGTGACTATGATGTTTACTCGAGTAAACATCATAGTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1412s21c1
Sequence:CCGGGGTGGTGTTTGAAGGGTAATACTCGAGTATTACCCTTCAAACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1716s21c1
Sequence:CCGGTGCTACTTCTGCGTCCATAAGCTCGAGCTTATGGACGCAGAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-314s1c1
Sequence:CCGGCCCAACAGCTACTTGTTGGTACTCGAGTACCAACAAGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-689s1c1
Sequence:CCGGGAACTGAATGTCAGCTTTATACTCGAGTATAAAGCTGACATTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-813s1c1
Sequence:CCGGAGAGCCATGATCTAATTCAAACTCGAGTTTGAATTAGATCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-601s1c1
Sequence:CCGGCATCTCAACATCGGACATCATCTCGAGATGATGTCCGATGTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-503s1c1
Sequence:CCGGGCTCATGATGACATTCCGTATCTCGAGATACGGAATGTCATCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004845
PCYT1B MISSION shRNA Lentiviral Transduction Particles
phosphate cytidylyltransferase 1, choline, beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004845.4-860s21c1
Sequence:CCGGTGTTCGTGACTATGATGTTTACTCGAGTAAACATCATAGTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1412s21c1
Sequence:CCGGGGTGGTGTTTGAAGGGTAATACTCGAGTATTACCCTTCAAACACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004845.4-1716s21c1
Sequence:CCGGTGCTACTTCTGCGTCCATAAGCTCGAGCTTATGGACGCAGAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-314s1c1
Sequence:CCGGCCCAACAGCTACTTGTTGGTACTCGAGTACCAACAAGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-689s1c1
Sequence:CCGGGAACTGAATGTCAGCTTTATACTCGAGTATAAAGCTGACATTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-813s1c1
Sequence:CCGGAGAGCCATGATCTAATTCAAACTCGAGTTTGAATTAGATCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-601s1c1
Sequence:CCGGCATCTCAACATCGGACATCATCTCGAGATGATGTCCGATGTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004845.2-503s1c1
Sequence:CCGGGCTCATGATGACATTCCGTATCTCGAGATACGGAATGTCATCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177546
PCYT1B MISSION shRNA Bacterial Glycerol Stock
phosphate cytidylyltransferase 1, choline, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177546.2-3554s1c1
Sequence:CCGGCCAGGTACAAACAGACACTTACTCGAGTAAGTGTCTGTTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-554s1c1
Sequence:CCGGGCTACTTGTTGGTAGGAGTTTCTCGAGAAACTCCTACCAACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-803s1c1
Sequence:CCGGGCATGTTTGTTCCAACACAAACTCGAGTTTGTGTTGGAACAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-463s1c1
Sequence:CCGGCCTGTTAGAGTGTATGCAGATCTCGAGATCTGCATACACTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-439s1c1
Sequence:CCGGCGCTTAGGAACACCAGTTGATCTCGAGATCAACTGGTGTTCCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177546
PCYT1B MISSION shRNA shRNA Plasmid DNA
phosphate cytidylyltransferase 1, choline, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177546.2-3554s1c1
Sequence:CCGGCCAGGTACAAACAGACACTTACTCGAGTAAGTGTCTGTTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-554s1c1
Sequence:CCGGGCTACTTGTTGGTAGGAGTTTCTCGAGAAACTCCTACCAACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-803s1c1
Sequence:CCGGGCATGTTTGTTCCAACACAAACTCGAGTTTGTGTTGGAACAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-463s1c1
Sequence:CCGGCCTGTTAGAGTGTATGCAGATCTCGAGATCTGCATACACTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-439s1c1
Sequence:CCGGCGCTTAGGAACACCAGTTGATCTCGAGATCAACTGGTGTTCCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177546
PCYT1B MISSION shRNA Lentiviral Transduction Particles
phosphate cytidylyltransferase 1, choline, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177546.2-3554s1c1
Sequence:CCGGCCAGGTACAAACAGACACTTACTCGAGTAAGTGTCTGTTTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-554s1c1
Sequence:CCGGGCTACTTGTTGGTAGGAGTTTCTCGAGAAACTCCTACCAACAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-803s1c1
Sequence:CCGGGCATGTTTGTTCCAACACAAACTCGAGTTTGTGTTGGAACAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-463s1c1
Sequence:CCGGCCTGTTAGAGTGTATGCAGATCTCGAGATCTGCATACACTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177546.2-439s1c1
Sequence:CCGGCGCTTAGGAACACCAGTTGATCTCGAGATCAACTGGTGTTCCTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks