EMAIL THIS PAGE TO A FRIEND

PDCL2

phosducin-like 2

Synonyms: GCPHLP
UniProtKB ID: Q8N4E4, A8MWA2, B9ZVQ9
Gene ID:
Human(132954) Summary: This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Mouse(79455) phosducin-like 2
Rat(498352) phosducin-like 2
cow(531753) phosducin-like 2
sheep(101116400) phosducin-like 2
naked mole-rat(101725664) phosducin-like 2
chicken(422749) phosducin-like 2
dog(475147) phosducin-like 2
domestic cat(101089765) phosducin-like 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152401 Rosetta Predictions human pricing
XM_001076368 Rosetta Predictions rat pricing
XM_573585 Rosetta Predictions rat pricing
NM_023508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083640 predicted 437
2 SASI_Hs01_00083641 predicted 418
3 SASI_Hs01_00083642 predicted 540
4 SASI_Hs01_00083643 predicted 288
5 SASI_Hs01_00083644 predicted 568
6 SASI_Hs01_00083645 predicted 495
7 SASI_Hs01_00083647 predicted 619
8 SASI_Hs01_00083648 predicted 520
9 SASI_Hs01_00083649 predicted 492
10 SASI_Hs02_00366083 predicted 487
11 SASI_Hs01_00083646 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353016 predicted 248
2 SASI_Rn02_00353017 predicted 389
3 SASI_Rn02_00353018 predicted 639
4 SASI_Rn02_00353019 predicted 827
5 SASI_Rn02_00353020 predicted 452
6 SASI_Rn02_00353021 predicted 406
7 SASI_Rn02_00353022 predicted 483
8 SASI_Rn02_00353023 predicted 543
9 SASI_Rn02_00353024 predicted 273
10 SASI_Rn02_00353025 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400523 predicted 631
2 SASI_Rn02_00400524 predicted 835
3 SASI_Rn02_00400525 predicted 881
4 SASI_Rn02_00400526 predicted 665
5 SASI_Rn02_00400527 predicted 893
6 SASI_Rn02_00400528 predicted 777
7 SASI_Rn02_00400529 predicted 530
8 SASI_Rn02_00400530 predicted 766
9 SASI_Rn02_00400531 predicted 705
10 SASI_Rn02_00400532 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170723 predicted 805
2 SASI_Mm01_00170724 predicted 451
3 SASI_Mm01_00170725 predicted 370
4 SASI_Mm01_00170726 predicted 837
5 SASI_Mm01_00170727 predicted 687
6 SASI_Mm01_00170728 predicted 384
7 SASI_Mm01_00170729 predicted 514
8 SASI_Mm01_00170730 predicted 507
9 SASI_Mm01_00170731 predicted 380
10 SASI_Mm01_00170732 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152401
PDCL2 MISSION shRNA Bacterial Glycerol Stock
phosducin-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-755s21c1
Sequence:CCGGATGGTATCTTCAATTAGAAACCTCGAGGTTTCTAATTGAAGATACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-700s21c1
Sequence:CCGGTGGAGCAATACAGACTGATTTCTCGAGAAATCAGTCTGTATTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-567s21c1
Sequence:CCGGACTACCATGACAATTGTTTACCTCGAGGTAAACAATTGTCATGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-641s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-542s1c1
Sequence:CCGGGCCATCGTGAATAGCTGTATTCTCGAGAATACAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-422s1c1
Sequence:CCGGGCAGAAGAAGATGTGTGGGTTCTCGAGAACCCACACATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-667s1c1
Sequence:CCGGGCTGGAAGAACTTGAATGGAACTCGAGTTCCATTCAAGTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-290s1c1
Sequence:CCGGGAAGAAGATATGCAGGCTGTTCTCGAGAACAGCCTGCATATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-496s1c1
Sequence:CCGGTCTTAGTCTTCTAGCAAGAAACTCGAGTTTCTTGCTAGAAGACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152401
PDCL2 MISSION shRNA shRNA Plasmid DNA
phosducin-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-755s21c1
Sequence:CCGGATGGTATCTTCAATTAGAAACCTCGAGGTTTCTAATTGAAGATACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-700s21c1
Sequence:CCGGTGGAGCAATACAGACTGATTTCTCGAGAAATCAGTCTGTATTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-567s21c1
Sequence:CCGGACTACCATGACAATTGTTTACCTCGAGGTAAACAATTGTCATGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-641s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-542s1c1
Sequence:CCGGGCCATCGTGAATAGCTGTATTCTCGAGAATACAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-422s1c1
Sequence:CCGGGCAGAAGAAGATGTGTGGGTTCTCGAGAACCCACACATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-667s1c1
Sequence:CCGGGCTGGAAGAACTTGAATGGAACTCGAGTTCCATTCAAGTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-290s1c1
Sequence:CCGGGAAGAAGATATGCAGGCTGTTCTCGAGAACAGCCTGCATATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-496s1c1
Sequence:CCGGTCTTAGTCTTCTAGCAAGAAACTCGAGTTTCTTGCTAGAAGACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152401
PDCL2 MISSION shRNA Lentiviral Transduction Particles
phosducin-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-755s21c1
Sequence:CCGGATGGTATCTTCAATTAGAAACCTCGAGGTTTCTAATTGAAGATACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-700s21c1
Sequence:CCGGTGGAGCAATACAGACTGATTTCTCGAGAAATCAGTCTGTATTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-567s21c1
Sequence:CCGGACTACCATGACAATTGTTTACCTCGAGGTAAACAATTGTCATGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152401.2-641s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-542s1c1
Sequence:CCGGGCCATCGTGAATAGCTGTATTCTCGAGAATACAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-422s1c1
Sequence:CCGGGCAGAAGAAGATGTGTGGGTTCTCGAGAACCCACACATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-667s1c1
Sequence:CCGGGCTGGAAGAACTTGAATGGAACTCGAGTTCCATTCAAGTTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-290s1c1
Sequence:CCGGGAAGAAGATATGCAGGCTGTTCTCGAGAACAGCCTGCATATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152401.2-496s1c1
Sequence:CCGGTCTTAGTCTTCTAGCAAGAAACTCGAGTTTCTTGCTAGAAGACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023508
PDCL2 MISSION shRNA Bacterial Glycerol Stock
phosducin-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-631s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-806s21c1
Sequence:CCGGAGGCTAAGTAGAACTTGTTAACTCGAGTTAACAAGTTCTACTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-740s21c1
Sequence:CCGGATATGATGGTGTCTTCAATTACTCGAGTAATTGAAGACACCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-565s21c1
Sequence:CCGGGACAACTGTTTACCAACAATTCTCGAGAATTGTTGGTAAACAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023508.3-856s1c1
Sequence:CCGGGCCTTATTTCCTGCTGACTTTCTCGAGAAAGTCAGCAGGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-532s1c1
Sequence:CCGGGCCATCGTGAATAGCTGCATTCTCGAGAATGCAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-426s1c1
Sequence:CCGGGTGGGTTGTAATTCATCTCTACTCGAGTAGAGATGAATTACAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-537s1c1
Sequence:CCGGCGTGAATAGCTGCATTGAACACTCGAGTGTTCAATGCAGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-670s1c1
Sequence:CCGGGAATGGAAACTATCAGAAGTTCTCGAGAACTTCTGATAGTTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023508
PDCL2 MISSION shRNA shRNA Plasmid DNA
phosducin-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-631s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-806s21c1
Sequence:CCGGAGGCTAAGTAGAACTTGTTAACTCGAGTTAACAAGTTCTACTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-740s21c1
Sequence:CCGGATATGATGGTGTCTTCAATTACTCGAGTAATTGAAGACACCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-565s21c1
Sequence:CCGGGACAACTGTTTACCAACAATTCTCGAGAATTGTTGGTAAACAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023508.3-856s1c1
Sequence:CCGGGCCTTATTTCCTGCTGACTTTCTCGAGAAAGTCAGCAGGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-532s1c1
Sequence:CCGGGCCATCGTGAATAGCTGCATTCTCGAGAATGCAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-426s1c1
Sequence:CCGGGTGGGTTGTAATTCATCTCTACTCGAGTAGAGATGAATTACAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-537s1c1
Sequence:CCGGCGTGAATAGCTGCATTGAACACTCGAGTGTTCAATGCAGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-670s1c1
Sequence:CCGGGAATGGAAACTATCAGAAGTTCTCGAGAACTTCTGATAGTTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023508
PDCL2 MISSION shRNA Lentiviral Transduction Particles
phosducin-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-631s21c1
Sequence:CCGGATAGAATGTGGAGGGATAAATCTCGAGATTTATCCCTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-806s21c1
Sequence:CCGGAGGCTAAGTAGAACTTGTTAACTCGAGTTAACAAGTTCTACTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-740s21c1
Sequence:CCGGATATGATGGTGTCTTCAATTACTCGAGTAATTGAAGACACCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023508.6-565s21c1
Sequence:CCGGGACAACTGTTTACCAACAATTCTCGAGAATTGTTGGTAAACAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023508.3-856s1c1
Sequence:CCGGGCCTTATTTCCTGCTGACTTTCTCGAGAAAGTCAGCAGGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-532s1c1
Sequence:CCGGGCCATCGTGAATAGCTGCATTCTCGAGAATGCAGCTATTCACGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-426s1c1
Sequence:CCGGGTGGGTTGTAATTCATCTCTACTCGAGTAGAGATGAATTACAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-537s1c1
Sequence:CCGGCGTGAATAGCTGCATTGAACACTCGAGTGTTCAATGCAGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023508.3-670s1c1
Sequence:CCGGGAATGGAAACTATCAGAAGTTCTCGAGAACTTCTGATAGTTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks