EMAIL THIS PAGE TO A FRIEND

PDE3B

phosphodiesterase 3B, cGMP-inhibited

Synonyms: HcGIP1 cGIPDE1
UniProtKB ID: Q13370, O00639, Q14408, Q6SEI4
Gene ID:
Mouse(18576) phosphodiesterase 3B, cGMP-inhibited
Rat(29516) phosphodiesterase 3B, cGMP-inhibited
Domestic Rabbit(100352820) phosphodiesterase 3B, cGMP-inhibited
naked mole-rat(101724440) phosphodiesterase 3B, cGMP-inhibited
domestic guinea pig(100731540) phosphodiesterase 3B, cGMP-inhibited
cow(533323) phosphodiesterase 3B, cGMP-inhibited
sheep(101121291) phosphodiesterase 3B, cGMP-inhibited
Zebrafish(563432) phosphodiesterase 3B, cGMP-inhibited
chicken(423064) phosphodiesterase 3B, cGMP-inhibited
dog(611730) phosphodiesterase 3B, cGMP-inhibited
domestic cat(101094877) phosphodiesterase 3B, cGMP-inhibited
Horse(100071615) phosphodiesterase 3B, cGMP-inhibited
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000922 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007721 MISSION® esiRNA esiRNA targeting mouse Pde3b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000922 Rosetta Predictions human pricing
NM_017229 Rosetta Predictions rat pricing
NM_011055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227359 predicted 2251
2 SASI_Hs01_00227360 predicted 2517
3 SASI_Hs02_00303501 predicted 3698
4 SASI_Hs02_00303502 predicted 3080
5 SASI_Hs01_00227362 predicted 1955
6 SASI_Hs01_00227363 predicted 2600
7 SASI_Hs01_00227364 predicted 2692
8 SASI_Hs01_00227365 predicted 3213
9 SASI_Hs01_00227366 predicted 1871
10 SASI_Hs02_00303503 predicted 1792
11 SASI_Hs01_00227361 predicted 2293
12 SASI_Hs01_00227367 predicted 1559
13 SASI_Hs01_00227368 predicted 3301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120779 predicted 3323
2 SASI_Rn01_00120780 predicted 916
3 SASI_Rn01_00120781 predicted 1141
4 SASI_Rn01_00120782 predicted 2098
5 SASI_Rn01_00120783 predicted 1641
6 SASI_Rn01_00120784 predicted 2323
7 SASI_Rn01_00120785 predicted 2737
8 SASI_Rn01_00120786 predicted 1799
9 SASI_Rn01_00120787 predicted 1011
10 SASI_Rn01_00120788 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030787 predicted 2591
2 SASI_Mm01_00030788 predicted 2311
3 SASI_Mm01_00030789 predicted 2950
4 SASI_Mm01_00030790 predicted 2809
5 SASI_Mm01_00030791 predicted 2574
6 SASI_Mm02_00319811 predicted 1471
7 SASI_Mm01_00030792 predicted 3641
8 SASI_Mm01_00030793 predicted 1622
9 SASI_Mm01_00030794 predicted 2635
10 SASI_Mm01_00030795 predicted 1288
11 SASI_Mm01_00030796 predicted 1960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011055
VALIDATED
PDE3B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 3B, cGMP-inhibited
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3673s1c1
Sequence:CCGGGCCTTAATACTGTGAGAGGATCTCGAGATCCTCTCACAGTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011055.1-1344s1c1
Sequence:CCGGGCGGAGTATCAGTAGCTTGATCTCGAGATCAAGCTACTGATACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-2344s1c1
Sequence:CCGGCCCACTCAAGAATTTATGAATCTCGAGATTCATAAATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3514s1c1
Sequence:CCGGGCAGATGAGATTCAGGTTATTCTCGAGAATAACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3419s1c1
Sequence:CCGGACCACAAGATATGGAAGGAAACTCGAGTTTCCTTCCATATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2115s21c1
Sequence:CCGGGAAAGCCTGCAGGGAGTTATTCTCGAGAATAACTCCCTGCAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2500s21c1
Sequence:CCGGGGCTTACCTCAGATCCATAATCTCGAGATTATGGATCTGAGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-1296s21c1
Sequence:CCGGGCTAAATGAAGCTCGCAATATCTCGAGATATTGCGAGCTTCATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011055.2-3628s21c1
Sequence:CCGGTGCTGTTCCCAGGGTCATTACCTCGAGGTAATGACCCTGGGAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011055
VALIDATED
PDE3B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 3B, cGMP-inhibited
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3673s1c1
Sequence:CCGGGCCTTAATACTGTGAGAGGATCTCGAGATCCTCTCACAGTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011055.1-1344s1c1
Sequence:CCGGGCGGAGTATCAGTAGCTTGATCTCGAGATCAAGCTACTGATACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-2344s1c1
Sequence:CCGGCCCACTCAAGAATTTATGAATCTCGAGATTCATAAATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3514s1c1
Sequence:CCGGGCAGATGAGATTCAGGTTATTCTCGAGAATAACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3419s1c1
Sequence:CCGGACCACAAGATATGGAAGGAAACTCGAGTTTCCTTCCATATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2115s21c1
Sequence:CCGGGAAAGCCTGCAGGGAGTTATTCTCGAGAATAACTCCCTGCAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2500s21c1
Sequence:CCGGGGCTTACCTCAGATCCATAATCTCGAGATTATGGATCTGAGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-1296s21c1
Sequence:CCGGGCTAAATGAAGCTCGCAATATCTCGAGATATTGCGAGCTTCATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011055.2-3628s21c1
Sequence:CCGGTGCTGTTCCCAGGGTCATTACCTCGAGGTAATGACCCTGGGAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011055
VALIDATED
PDE3B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 3B, cGMP-inhibited
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3673s1c1
Sequence:CCGGGCCTTAATACTGTGAGAGGATCTCGAGATCCTCTCACAGTATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011055.1-1344s1c1
Sequence:CCGGGCGGAGTATCAGTAGCTTGATCTCGAGATCAAGCTACTGATACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-2344s1c1
Sequence:CCGGCCCACTCAAGAATTTATGAATCTCGAGATTCATAAATTCTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3514s1c1
Sequence:CCGGGCAGATGAGATTCAGGTTATTCTCGAGAATAACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011055.1-3419s1c1
Sequence:CCGGACCACAAGATATGGAAGGAAACTCGAGTTTCCTTCCATATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2115s21c1
Sequence:CCGGGAAAGCCTGCAGGGAGTTATTCTCGAGAATAACTCCCTGCAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-2500s21c1
Sequence:CCGGGGCTTACCTCAGATCCATAATCTCGAGATTATGGATCTGAGGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011055.2-1296s21c1
Sequence:CCGGGCTAAATGAAGCTCGCAATATCTCGAGATATTGCGAGCTTCATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011055.2-3628s21c1
Sequence:CCGGTGCTGTTCCCAGGGTCATTACCTCGAGGTAATGACCCTGGGAACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000922
VALIDATED
PDE3B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 3B, cGMP-inhibited
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-2887s1c1
Sequence:CCGGCCAGAATACAACTTCCTTCTTCTCGAGAAGAAGGAAGTTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-3586s1c1
Sequence:CCGGGCAGATGAGATTCAGGTAATTCTCGAGAATTACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-2666s1c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-1259s1c1
Sequence:CCGGCCAGAGAACAGATGATTCTTTCTCGAGAAAGAATCATCTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-1366s1c1
Sequence:CCGGGCTCGCAATATGGTGTCAGATCTCGAGATCTGACACCATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2728s21c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-3148s21c1
Sequence:CCGGGCATCAAACTGGCAGATATAACTCGAGTTATATCTGCCAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-1493s21c1
Sequence:CCGGACGGAGTATTAGTAGCTTAATCTCGAGATTAAGCTACTAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2919s21c1
Sequence:CCGGGCGTCAGCTTGGAATCTATATCTCGAGATATAGATTCCAAGCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000922.3-3924s21c1
Sequence:CCGGTGTTGCAGAGCCCTTACTTAACTCGAGTTAAGTAAGGGCTCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000922
VALIDATED
PDE3B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 3B, cGMP-inhibited
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-2887s1c1
Sequence:CCGGCCAGAATACAACTTCCTTCTTCTCGAGAAGAAGGAAGTTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-3586s1c1
Sequence:CCGGGCAGATGAGATTCAGGTAATTCTCGAGAATTACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-2666s1c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-1259s1c1
Sequence:CCGGCCAGAGAACAGATGATTCTTTCTCGAGAAAGAATCATCTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-1366s1c1
Sequence:CCGGGCTCGCAATATGGTGTCAGATCTCGAGATCTGACACCATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2728s21c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-3148s21c1
Sequence:CCGGGCATCAAACTGGCAGATATAACTCGAGTTATATCTGCCAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-1493s21c1
Sequence:CCGGACGGAGTATTAGTAGCTTAATCTCGAGATTAAGCTACTAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2919s21c1
Sequence:CCGGGCGTCAGCTTGGAATCTATATCTCGAGATATAGATTCCAAGCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000922.3-3924s21c1
Sequence:CCGGTGTTGCAGAGCCCTTACTTAACTCGAGTTAAGTAAGGGCTCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000922
VALIDATED
PDE3B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 3B, cGMP-inhibited
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-2887s1c1
Sequence:CCGGCCAGAATACAACTTCCTTCTTCTCGAGAAGAAGGAAGTTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-3586s1c1
Sequence:CCGGGCAGATGAGATTCAGGTAATTCTCGAGAATTACCTGAATCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-2666s1c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000922.2-1259s1c1
Sequence:CCGGCCAGAGAACAGATGATTCTTTCTCGAGAAAGAATCATCTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000922.2-1366s1c1
Sequence:CCGGGCTCGCAATATGGTGTCAGATCTCGAGATCTGACACCATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2728s21c1
Sequence:CCGGGCTCTAATCCTGATGAGAGTTCTCGAGAACTCTCATCAGGATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-3148s21c1
Sequence:CCGGGCATCAAACTGGCAGATATAACTCGAGTTATATCTGCCAGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-1493s21c1
Sequence:CCGGACGGAGTATTAGTAGCTTAATCTCGAGATTAAGCTACTAATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000922.3-2919s21c1
Sequence:CCGGGCGTCAGCTTGGAATCTATATCTCGAGATATAGATTCCAAGCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000922.3-3924s21c1
Sequence:CCGGTGTTGCAGAGCCCTTACTTAACTCGAGTTAAGTAAGGGCTCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks