EMAIL THIS PAGE TO A FRIEND

PDE8A

phosphodiesterase 8A

Synonyms: HsT19550
Gene ID:
Human(5151) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Mouse(18584) phosphodiesterase 8A
Rat(308776) phosphodiesterase 8A
Zebrafish(791145) phosphodiesterase 8A
chicken(415455) phosphodiesterase 8A
dog(488752) phosphodiesterase 8A
domestic cat(101086313) phosphodiesterase 8A
cow(506787) phosphodiesterase 8A
sheep(101105363) phosphodiesterase 8A
Domestic Rabbit(100343099) phosphodiesterase 8A
naked mole-rat(101697131) phosphodiesterase 8A
domestic guinea pig(100302670) phosphodiesterase 8A
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002605 siRNAs that have been validated in the lab human pricing
NM_173454 Rosetta Predictions human pricing
NM_173455 Rosetta Predictions human pricing
NM_173456 Rosetta Predictions human pricing
NM_173457 Rosetta Predictions human pricing
NM_198767 Rosetta Predictions rat pricing
NM_008803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002605 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000038 validated 2711
1 SASI_WI_00000039 validated 497
1 SASI_WI_00000037 validated 1913
2 SASI_Hs01_00214723 predicted 1913
3 SASI_Hs01_00214724 predicted 1462
4 SASI_Hs02_00334118 predicted 1259
5 SASI_Hs01_00214725 predicted 1330
6 SASI_Hs01_00214727 predicted 1965
7 SASI_Hs01_00214728 predicted 2314
8 SASI_Hs01_00214729 predicted 2335
9 SASI_Hs01_00214730 predicted 1799
10 SASI_Hs01_00214731 predicted 2513
11 SASI_Hs01_00214732 predicted 2193
12 SASI_Hs01_00214726 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215287 predicted 1770
2 SASI_Hs01_00215288 predicted 1324
3 SASI_Hs02_00368197 predicted 1120
4 SASI_Hs01_00215289 predicted 1197
5 SASI_Hs01_00215291 predicted 1828
6 SASI_Hs01_00215292 predicted 2176
7 SASI_Hs01_00215293 predicted 2201
8 SASI_Hs01_00215294 predicted 1661
9 SASI_Hs01_00215295 predicted 2374
10 SASI_Hs01_00215296 predicted 2057
11 SASI_Hs01_00215290 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055552 predicted 1693
2 SASI_Hs01_00055553 predicted 1241
3 SASI_Hs01_00055554 predicted 1122
4 SASI_Hs01_00055555 predicted 1156
5 SASI_Hs01_00055556 predicted 1754
6 SASI_Hs01_00055557 predicted 2109
7 SASI_Hs01_00055558 predicted 2126
8 SASI_Hs01_00055559 predicted 1587
9 SASI_Hs01_00055560 predicted 2308
10 SASI_Hs01_00055561 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188251 predicted 1837
2 SASI_Hs01_00188252 predicted 1386
3 SASI_Hs01_00188253 predicted 1190
4 SASI_Hs01_00188254 predicted 1256
5 SASI_Hs01_00188255 predicted 1291
6 SASI_Hs01_00188256 predicted 1893
7 SASI_Hs01_00188257 predicted 2247
8 SASI_Hs01_00188258 predicted 2259
9 SASI_Hs01_00188259 predicted 1718
10 SASI_Hs01_00188260 predicted 2445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125974 predicted 2108
2 SASI_Hs01_00125975 predicted 1656
3 SASI_Hs01_00125976 predicted 1468
4 SASI_Hs01_00125977 predicted 1540
5 SASI_Hs01_00125978 predicted 1574
6 SASI_Hs01_00125979 predicted 2171
7 SASI_Hs01_00125980 predicted 2524
8 SASI_Hs01_00125981 predicted 2542
9 SASI_Hs01_00125982 predicted 2000
10 SASI_Hs01_00125983 predicted 2718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270010 predicted 750
2 SASI_Rn01_00104387 predicted 1777
3 SASI_Rn02_00270011 predicted 709
4 SASI_Rn01_00104388 predicted 506
5 SASI_Rn01_00104390 predicted 723
6 SASI_Rn01_00104391 predicted 904
7 SASI_Rn01_00104392 predicted 2089
8 SASI_Rn01_00104394 predicted 519
9 SASI_Rn02_00270012 predicted 2015
10 SASI_Rn01_00104395 predicted 318
11 SASI_Rn01_00104386 predicted 1497
12 SASI_Rn01_00104389 predicted 787
13 SASI_Rn01_00104393 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120070 predicted 2016
2 SASI_Mm01_00120071 predicted 736
3 SASI_Mm01_00120072 predicted 772
4 SASI_Mm01_00120073 predicted 562
5 SASI_Mm01_00120074 predicted 1126
6 SASI_Mm01_00120076 predicted 1828
7 SASI_Mm01_00120078 predicted 326
8 SASI_Mm02_00314720 predicted 897
9 SASI_Mm01_00120079 predicted 2072
10 SASI_Mm02_00314721 predicted 1671
11 SASI_Mm01_00120075 predicted 1029
12 SASI_Mm01_00120077 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002605
VALIDATED
PDE8A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 8A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-449s21c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002605.2-1800s21c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-1335s21c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-997s21c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-2413s21c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1328s1c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-2406s1c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-990s1c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-442s1c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1793s1c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002605
VALIDATED
PDE8A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 8A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-449s21c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002605.2-1800s21c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-1335s21c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-997s21c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-2413s21c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1328s1c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-2406s1c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-990s1c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-442s1c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1793s1c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002605
VALIDATED
PDE8A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 8A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-449s21c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002605.2-1800s21c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-1335s21c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-997s21c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002605.2-2413s21c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1328s1c1
Sequence:CCGGCCGGATACATTCCATGACAATCTCGAGATTGTCATGGAATGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-2406s1c1
Sequence:CCGGGCACGCATTTCGGAAGAATATCTCGAGATATTCTTCCGAAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-990s1c1
Sequence:CCGGGCTGACTTGCTCGATACTATACTCGAGTATAGTATCGAGCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-442s1c1
Sequence:CCGGCCAAAGAAGATAACCAATGTACTCGAGTACATTGGTTATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002605.1-1793s1c1
Sequence:CCGGGCTAAGATCATGGTTACAAATCTCGAGATTTGTAACCATGATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008803
VALIDATED
PDE8A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 8A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-2557s1c1
Sequence:CCGGCCTAACCTTATGCAGCACCTACTCGAGTAGGTGCTGCATAAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-1262s1c1
Sequence:CCGGCCTCCAGAACAAGTGACGTTTCTCGAGAAACGTCACTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-3210s1c1
Sequence:CCGGCCCACACTATGGAATATGTTACTCGAGTAACATATTCCATAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008803.1-1453s1c1
Sequence:CCGGCCACAGTTTAATGCTCAGGATCTCGAGATCCTGAGCATTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-888s1c1
Sequence:CCGGCCCTGCATTTGAATCAACAATCTCGAGATTGTTGATTCAAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008803
VALIDATED
PDE8A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 8A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-2557s1c1
Sequence:CCGGCCTAACCTTATGCAGCACCTACTCGAGTAGGTGCTGCATAAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-1262s1c1
Sequence:CCGGCCTCCAGAACAAGTGACGTTTCTCGAGAAACGTCACTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-3210s1c1
Sequence:CCGGCCCACACTATGGAATATGTTACTCGAGTAACATATTCCATAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008803.1-1453s1c1
Sequence:CCGGCCACAGTTTAATGCTCAGGATCTCGAGATCCTGAGCATTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-888s1c1
Sequence:CCGGCCCTGCATTTGAATCAACAATCTCGAGATTGTTGATTCAAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008803
VALIDATED
PDE8A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 8A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-2557s1c1
Sequence:CCGGCCTAACCTTATGCAGCACCTACTCGAGTAGGTGCTGCATAAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-1262s1c1
Sequence:CCGGCCTCCAGAACAAGTGACGTTTCTCGAGAAACGTCACTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-3210s1c1
Sequence:CCGGCCCACACTATGGAATATGTTACTCGAGTAACATATTCCATAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008803.1-1453s1c1
Sequence:CCGGCCACAGTTTAATGCTCAGGATCTCGAGATCCTGAGCATTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008803.1-888s1c1
Sequence:CCGGCCCTGCATTTGAATCAACAATCTCGAGATTGTTGATTCAAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks