EMAIL THIS PAGE TO A FRIEND

PDF

peptide deformylase (mitochondrial)

UniProtKB ID: Q9HBH1, Q8WUN6
Gene ID:
Human(64146) Summary: Protein synthesis proceeds after formylation of methionine by methionyl-tRNA formyl transferase (FMT) and transfer of the charged initiator f-met tRNA to the ribosome. In eubacteria and eukaryotic organelles the product of this gene, peptide deformylase (PDF), removes the formyl group from the initiating methionine of nascent peptides. In eubacteria, deformylation of nascent peptides is required for subsequent cleavage of initiating methionines by methionine aminopeptidase. The discovery that a natural inhibitor of PDF, actinonin, acts as an antimicrobial agent in some bacteria has spurred intensive research into the design of bacterial-specific PDF inhibitors. In human cells, only mitochondrial proteins have N-formylation of initiating methionines. Protein inhibitors of PDF or siRNAs of PDF block the growth of cancer cell lines but have no effect on normal cell growth. In humans, PDF function may therefore be restricted to rapidly growing cells. [provided by RefSeq, Nov 2008]
Mouse(68023) peptide deformylase (mitochondrial)
Rat(690214) peptide deformylase (mitochondrial)
cow(788473) peptide deformylase (mitochondrial)
sheep(101112923) peptide deformylase (mitochondrial)
naked mole-rat(101714125) peptide deformylase (mitochondrial)
fruit fly(43193) Pigment-dispersing factor
domestic cat(101082868) peptide deformylase (mitochondrial)
dog(610955) peptide deformylase (mitochondrial)
Zebrafish(619248) peptide deformylase (mitochondrial)
fruit fly(45914) pod foot
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022341 Rosetta Predictions human pricing
XM_001073696 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156802 predicted 813
2 SASI_Hs01_00156803 predicted 920
3 SASI_Hs02_00355622 predicted 842
4 SASI_Hs01_00156804 predicted 805
5 SASI_Hs01_00156805 predicted 924
6 SASI_Hs01_00156806 predicted 922
7 SASI_Hs01_00156808 predicted 841
8 SASI_Hs01_00156809 predicted 817
9 SASI_Hs01_00156810 predicted 805
10 SASI_Hs02_00355623 predicted 845
11 SASI_Hs01_00156801 predicted 856
12 SASI_Hs01_00156807 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343595 predicted 684
2 SASI_Rn02_00343596 predicted 985
3 SASI_Rn02_00343597 predicted 975
4 SASI_Rn02_00343598 predicted 830
5 SASI_Rn02_00343599 predicted 803
6 SASI_Rn02_00343600 predicted 708
7 SASI_Rn02_00343601 predicted 918
8 SASI_Rn02_00343602 predicted 691
9 SASI_Rn02_00343603 predicted 887
10 SASI_Rn02_00343604 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022341
PDF MISSION shRNA Bacterial Glycerol Stock
peptide deformylase (mitochondrial)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-514s1c1
Sequence:CCGGCCGCCTGGTCACCTTTCCCGACTCGAGTCGGGAAAGGTGACCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-448s1c1
Sequence:CCGGGCTCCGCCAAATGGAGCCCTTCTCGAGAAGGGCTCCATTTGGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-730s1c1
Sequence:CCGGCGTCTATTGGATGAAGGTGAACTCGAGTTCACCTTCATCCAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-160s1c1
Sequence:CCGGGCGCTCCTATTGGCGCCACCTCTCGAGAGGTGGCGCCAATAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-839s21c1
Sequence:CCGGCAACTTGGATGGCTCGCATATCTCGAGATATGCGAGCCATCCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-680s21c1
Sequence:CCGGCTGCAGGGCTGCCTGTTTATTCTCGAGAATAAACAGGCAGCCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-986s21c1
Sequence:CCGGAGTGGACATTTCCTAACAATTCTCGAGAATTGTTAGGAAATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-708s21c1
Sequence:CCGGTGGACAGCAGGACGTTCACAACTCGAGTTGTGAACGTCCTGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022341
PDF MISSION shRNA shRNA Plasmid DNA
peptide deformylase (mitochondrial)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-514s1c1
Sequence:CCGGCCGCCTGGTCACCTTTCCCGACTCGAGTCGGGAAAGGTGACCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-448s1c1
Sequence:CCGGGCTCCGCCAAATGGAGCCCTTCTCGAGAAGGGCTCCATTTGGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-730s1c1
Sequence:CCGGCGTCTATTGGATGAAGGTGAACTCGAGTTCACCTTCATCCAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-160s1c1
Sequence:CCGGGCGCTCCTATTGGCGCCACCTCTCGAGAGGTGGCGCCAATAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-839s21c1
Sequence:CCGGCAACTTGGATGGCTCGCATATCTCGAGATATGCGAGCCATCCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-680s21c1
Sequence:CCGGCTGCAGGGCTGCCTGTTTATTCTCGAGAATAAACAGGCAGCCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-986s21c1
Sequence:CCGGAGTGGACATTTCCTAACAATTCTCGAGAATTGTTAGGAAATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-708s21c1
Sequence:CCGGTGGACAGCAGGACGTTCACAACTCGAGTTGTGAACGTCCTGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022341
PDF MISSION shRNA Lentiviral Transduction Particles
peptide deformylase (mitochondrial)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-514s1c1
Sequence:CCGGCCGCCTGGTCACCTTTCCCGACTCGAGTCGGGAAAGGTGACCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-448s1c1
Sequence:CCGGGCTCCGCCAAATGGAGCCCTTCTCGAGAAGGGCTCCATTTGGCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-730s1c1
Sequence:CCGGCGTCTATTGGATGAAGGTGAACTCGAGTTCACCTTCATCCAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022341.1-160s1c1
Sequence:CCGGGCGCTCCTATTGGCGCCACCTCTCGAGAGGTGGCGCCAATAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-839s21c1
Sequence:CCGGCAACTTGGATGGCTCGCATATCTCGAGATATGCGAGCCATCCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-680s21c1
Sequence:CCGGCTGCAGGGCTGCCTGTTTATTCTCGAGAATAAACAGGCAGCCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022341.1-986s21c1
Sequence:CCGGAGTGGACATTTCCTAACAATTCTCGAGAATTGTTAGGAAATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022341.1-708s21c1
Sequence:CCGGTGGACAGCAGGACGTTCACAACTCGAGTTGTGAACGTCCTGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks