EMAIL THIS PAGE TO A FRIEND

PDGFRB

platelet-derived growth factor receptor, beta polypeptide

Synonyms: CD140B IBGC4 IMF1 JTK12 PDGFR PDGFR-1 PDGFR1
UniProtKB ID: P09619, Q8N5L4
Gene ID:
Human(5159) Summary: This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
Mouse(18596) platelet derived growth factor receptor, beta polypeptide
Rat(24629) platelet derived growth factor receptor, beta polypeptide
Zebrafish(559529) platelet-derived growth factor receptor beta
domestic cat(101084600) platelet-derived growth factor receptor, beta polypeptide
dog(442985) platelet-derived growth factor receptor, beta polypeptide
chicken(770488) platelet-derived growth factor receptor, beta polypeptide
cow(527165) platelet-derived growth factor receptor, beta polypeptide
sheep(101122783) platelet-derived growth factor receptor, beta polypeptide
domestic guinea pig(100726506) platelet-derived growth factor receptor, beta polypeptide
naked mole-rat(101721151) platelet-derived growth factor receptor, beta polypeptide
Domestic Rabbit(100342872) platelet-derived growth factor receptor, beta polypeptide
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302551 ANTI-MOUSE PDGFRB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4502149 Anti-PDGF Receptor β antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502147 Anti-PDGFR β antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502148 Anti-PDGFR β, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300478 Anti-PDGFRB (Ab-751) antibody produced in rabbit affinity isolated antibody human, rat
western blot pricing
SAB1406238 Anti-PDGFRB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA028499 Anti-PDGFRB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502146 Anti-PDGFRB, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4504513 Anti-phospho-PDGF Receptor β (pTyr751) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4504202 Anti-phospho-PDGFR β (pTyr740) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301439 Anti-phospho-PDGFR β (pTyr740) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4301407 Anti-phospho-PDGFRb (pTyr771) antibody produced in rabbit affinity isolated antibody human
western blot pricing
P2229 Anti-Platelet-Derived Growth Factor Soluble Receptor β antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, flow cytometry, immunohistochemistry, neutralization, western blot pricing
SAB4700458 Monoclonal Anti-CD140b antibody produced in mouse clone 18A2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700459 Monoclonal Anti-CD140b-APC antibody produced in mouse clone 18A2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700460 Monoclonal Anti-CD140b-PE antibody produced in mouse clone 18A2, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1305510 MONOCLONAL ANTI-PDGFR antibody produced in mouse clone 275CT1, crude ascites, buffered aqueous solution mouse
western blot pricing
WH0005159M8 Monoclonal Anti-PDGFRB antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002609 siRNAs that have been validated in the lab human pricing
NM_031525 Rosetta Predictions rat pricing
NM_008809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002609 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241713 validated 1247
1 SASI_Hs01_00241711 validated 2336
1 SASI_Hs01_00241712 validated 620
2 SASI_Hs01_00241714 predicted 2752
3 SASI_Hs01_00241715 predicted 2348
4 SASI_Hs01_00241716 predicted 2116
5 SASI_Hs02_00334121 predicted 1352
6 SASI_Hs01_00241718 predicted 1178
7 SASI_Hs01_00241719 predicted 2730
8 SASI_Hs01_00241720 predicted 2484
9 SASI_Hs01_00241717 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045880 predicted 883
2 SASI_Rn01_00045881 predicted 2044
3 SASI_Rn01_00045882 predicted 1141
4 SASI_Rn02_00264666 predicted 2624
5 SASI_Rn01_00045883 predicted 1242
6 SASI_Rn01_00045884 predicted 1583
7 SASI_Rn01_00045885 predicted 1262
8 SASI_Rn01_00045887 predicted 2573
9 SASI_Rn01_00045888 predicted 2234
10 SASI_Rn01_00045889 predicted 1374
11 SASI_Rn01_00045886 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097277 predicted 2012
2 SASI_Mm01_00097278 predicted 3432
3 SASI_Mm01_00097279 predicted 914
4 SASI_Mm01_00097280 predicted 837
5 SASI_Mm01_00097281 predicted 983
6 SASI_Mm01_00097282 predicted 1701
7 SASI_Mm01_00097283 predicted 1809
8 SASI_Mm01_00097284 predicted 2681
9 SASI_Mm01_00097286 predicted 1297
10 SASI_Mm02_00314735 predicted 1014
11 SASI_Mm01_00097285 predicted 2402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002609
PDGFRB MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor receptor, beta polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-3724s1c1
Sequence:CCGGGCTGGAACAGTTGCCGGATTCCTCGAGGAATCCGGCAACTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-904s1c1
Sequence:CCGGCACCATTCCATGCCGAGTAACCTCGAGGTTACTCGGCATGGAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2834s1c1
Sequence:CCGGGCAACTTTGATCAACGAGTCTCTCGAGAGACTCGTTGATCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-1985s1c1
Sequence:CCGGGCTCACCATCATCTCCCTTATCTCGAGATAAGGGAGATGATGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2916s1c1
Sequence:CCGGGACTCGAATTACATCTCCAAACTCGAGTTTGGAGATGTAATTCGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-951s1c1
Sequence:CCGGGTGGATTCTGATGCCTACTATCTCGAGATAGTAGGCATCAGAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2371s1c1
Sequence:CCGGCCAAAGGAGGACCCATCTATACTCGAGTATAGATGGGTCCTCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002609.x-4435s1c1
Sequence:CCGGCCCTCAGTCTTAATCCATCCACTCGAGTGGATGGATTAAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002609.3-3020s21c1
Sequence:GTACCGGATCATGCGGGACTCGAATTACCTCGAGGTAATTCGAGTCCCGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2150s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002609
PDGFRB MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor receptor, beta polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-3724s1c1
Sequence:CCGGGCTGGAACAGTTGCCGGATTCCTCGAGGAATCCGGCAACTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-904s1c1
Sequence:CCGGCACCATTCCATGCCGAGTAACCTCGAGGTTACTCGGCATGGAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2834s1c1
Sequence:CCGGGCAACTTTGATCAACGAGTCTCTCGAGAGACTCGTTGATCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-1985s1c1
Sequence:CCGGGCTCACCATCATCTCCCTTATCTCGAGATAAGGGAGATGATGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2916s1c1
Sequence:CCGGGACTCGAATTACATCTCCAAACTCGAGTTTGGAGATGTAATTCGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-951s1c1
Sequence:CCGGGTGGATTCTGATGCCTACTATCTCGAGATAGTAGGCATCAGAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2371s1c1
Sequence:CCGGCCAAAGGAGGACCCATCTATACTCGAGTATAGATGGGTCCTCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002609.x-4435s1c1
Sequence:CCGGCCCTCAGTCTTAATCCATCCACTCGAGTGGATGGATTAAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002609.3-3020s21c1
Sequence:GTACCGGATCATGCGGGACTCGAATTACCTCGAGGTAATTCGAGTCCCGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2150s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002609
PDGFRB MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor receptor, beta polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-3724s1c1
Sequence:CCGGGCTGGAACAGTTGCCGGATTCCTCGAGGAATCCGGCAACTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-904s1c1
Sequence:CCGGCACCATTCCATGCCGAGTAACCTCGAGGTTACTCGGCATGGAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2834s1c1
Sequence:CCGGGCAACTTTGATCAACGAGTCTCTCGAGAGACTCGTTGATCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-1985s1c1
Sequence:CCGGGCTCACCATCATCTCCCTTATCTCGAGATAAGGGAGATGATGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2916s1c1
Sequence:CCGGGACTCGAATTACATCTCCAAACTCGAGTTTGGAGATGTAATTCGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-951s1c1
Sequence:CCGGGTGGATTCTGATGCCTACTATCTCGAGATAGTAGGCATCAGAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002609.x-2371s1c1
Sequence:CCGGCCAAAGGAGGACCCATCTATACTCGAGTATAGATGGGTCCTCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002609.x-4435s1c1
Sequence:CCGGCCCTCAGTCTTAATCCATCCACTCGAGTGGATGGATTAAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002609.3-3020s21c1
Sequence:GTACCGGATCATGCGGGACTCGAATTACCTCGAGGTAATTCGAGTCCCGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002609.3-2150s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008809
VALIDATED
PDGFRB MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor receptor, beta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3956s1c1
Sequence:CCGGCCATGCTTAATGAATGCTGTTCTCGAGAACAGCATTCATTAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3278s1c1
Sequence:CCGGCCTTGAATGAAGTCAACACTTCTCGAGAAGTGTTGACTTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-2868s1c1
Sequence:CCGGCCAGTTCTACAATGCCATCAACTCGAGTTGATGGCATTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2865s1c1
Sequence:CCGGCGACCAGTTCTACAATGCCATCTCGAGATGGCATTGTAGAACTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2217s1c1
Sequence:CCGGCCGGAACAAACACACCTTCTTCTCGAGAAGAAGGTGTGTTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-4047s21c1
Sequence:CCGGGTACGGTGGTGTGTTCATATCCTCGAGGATATGAACACACCACCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-758s21c1
Sequence:CCGGGTGAGAGGAAGCGTATCTATACTCGAGTATAGATACGCTTCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-1594s21c1
Sequence:CCGGGAAGCGGGCTACTATACTATGCTCGAGCATAGTATAGTAGCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-847s21c1
Sequence:CCGGGATGTCACTGAGACGACAATTCTCGAGAATTGTCGTCTCAGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-3307s21c1
Sequence:CCGGCTTCTGGGTGAAGGCTATAAACTCGAGTTTATAGCCTTCACCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008809
VALIDATED
PDGFRB MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor receptor, beta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3956s1c1
Sequence:CCGGCCATGCTTAATGAATGCTGTTCTCGAGAACAGCATTCATTAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3278s1c1
Sequence:CCGGCCTTGAATGAAGTCAACACTTCTCGAGAAGTGTTGACTTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-2868s1c1
Sequence:CCGGCCAGTTCTACAATGCCATCAACTCGAGTTGATGGCATTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2865s1c1
Sequence:CCGGCGACCAGTTCTACAATGCCATCTCGAGATGGCATTGTAGAACTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2217s1c1
Sequence:CCGGCCGGAACAAACACACCTTCTTCTCGAGAAGAAGGTGTGTTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-4047s21c1
Sequence:CCGGGTACGGTGGTGTGTTCATATCCTCGAGGATATGAACACACCACCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-758s21c1
Sequence:CCGGGTGAGAGGAAGCGTATCTATACTCGAGTATAGATACGCTTCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-1594s21c1
Sequence:CCGGGAAGCGGGCTACTATACTATGCTCGAGCATAGTATAGTAGCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-847s21c1
Sequence:CCGGGATGTCACTGAGACGACAATTCTCGAGAATTGTCGTCTCAGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-3307s21c1
Sequence:CCGGCTTCTGGGTGAAGGCTATAAACTCGAGTTTATAGCCTTCACCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008809
VALIDATED
PDGFRB MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor receptor, beta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3956s1c1
Sequence:CCGGCCATGCTTAATGAATGCTGTTCTCGAGAACAGCATTCATTAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-3278s1c1
Sequence:CCGGCCTTGAATGAAGTCAACACTTCTCGAGAAGTGTTGACTTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008809.1-2868s1c1
Sequence:CCGGCCAGTTCTACAATGCCATCAACTCGAGTTGATGGCATTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2865s1c1
Sequence:CCGGCGACCAGTTCTACAATGCCATCTCGAGATGGCATTGTAGAACTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008809.1-2217s1c1
Sequence:CCGGCCGGAACAAACACACCTTCTTCTCGAGAAGAAGGTGTGTTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-4047s21c1
Sequence:CCGGGTACGGTGGTGTGTTCATATCCTCGAGGATATGAACACACCACCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-758s21c1
Sequence:CCGGGTGAGAGGAAGCGTATCTATACTCGAGTATAGATACGCTTCCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-1594s21c1
Sequence:CCGGGAAGCGGGCTACTATACTATGCTCGAGCATAGTATAGTAGCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-847s21c1
Sequence:CCGGGATGTCACTGAGACGACAATTCTCGAGAATTGTCGTCTCAGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008809.2-3307s21c1
Sequence:CCGGCTTCTGGGTGAAGGCTATAAACTCGAGTTTATAGCCTTCACCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks