EMAIL THIS PAGE TO A FRIEND

PDIA2

protein disulfide isomerase family A, member 2

Synonyms: PDA2 PDI PDIP PDIR
Gene ID:
Human(64714) Summary: Protein disulfide isomerases (EC 5.3.4.1), such as PDIP, are endoplasmic reticulum (ER) resident proteins that catalyze protein folding and thiol-disulfide interchange reactions (Desilva et al., 1996 [PubMed 8561901]
Mouse(69191) protein disulfide isomerase associated 2
Rat(287164) protein disulfide isomerase family A, member 2
Zebrafish(394023) protein disulfide isomerase family A, member 2
dog(100687738) protein disulfide isomerase family A, member 2
domestic cat(101089065) protein disulfide isomerase family A, member 2
cow(504356) protein disulfide isomerase family A, member 2
sheep(101122403) protein disulfide isomerase family A, member 2
domestic guinea pig(100713422) protein disulfide isomerase family A, member 2
naked mole-rat(101701648) protein disulfide isomerase family A, member 2
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006849 Rosetta Predictions human pricing
NM_001105775 Rosetta Predictions rat pricing
NM_001081070 Rosetta Predictions mouse pricing
XM_128552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240626 predicted 1148
2 SASI_Hs01_00240627 predicted 400
3 SASI_Hs01_00240628 predicted 1169
4 SASI_Hs01_00240629 predicted 395
5 SASI_Hs01_00240630 predicted 1197
6 SASI_Hs01_00240631 predicted 1017
7 SASI_Hs01_00240632 predicted 388
8 SASI_Hs01_00240633 predicted 704
9 SASI_Hs01_00240634 predicted 374
10 SASI_Hs01_00240635 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212406 predicted 737
2 SASI_Rn02_00212407 predicted 1313
3 SASI_Rn02_00212408 predicted 553
4 SASI_Rn02_00212409 predicted 877
5 SASI_Rn02_00212410 predicted 504
6 SASI_Rn02_00212411 predicted 229
7 SASI_Rn02_00212412 predicted 1420
8 SASI_Rn02_00212413 predicted 798
9 SASI_Rn02_00212414 predicted 415
10 SASI_Rn02_00212415 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294881 predicted 593
2 SASI_Mm02_00294882 predicted 708
3 SASI_Mm02_00294883 predicted 416
4 SASI_Mm02_00294884 predicted 849
5 SASI_Mm02_00294885 predicted 1450
6 SASI_Mm02_00294886 predicted 558
7 SASI_Mm02_00294887 predicted 1395
8 SASI_Mm02_00294888 predicted 613
9 SASI_Mm02_00294889 predicted 1402
10 SASI_Mm02_00294890 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251735 predicted 602
2 SASI_Mm01_00251736 predicted 719
3 SASI_Mm01_00251737 predicted 418
4 SASI_Mm01_00251738 predicted 856
5 SASI_Mm01_00251739 predicted 869
6 SASI_Mm01_00251740 predicted 565
7 SASI_Mm01_00251741 predicted 1402
8 SASI_Mm01_00251742 predicted 611
9 SASI_Mm01_00251743 predicted 1408
10 SASI_Mm01_00251744 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006849
PDIA2 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1398s1c1
Sequence:CCGGAGGTCGGAAGGTGATTGAATACTCGAGTATTCAATCACCTTCCGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1397s1c1
Sequence:CCGGCAGGTCGGAAGGTGATTGAATCTCGAGATTCAATCACCTTCCGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1297s1c1
Sequence:CCGGCACGAGGACATCATCATTGCTCTCGAGAGCAATGATGATGTCCTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-398s21c1
Sequence:CCGGGAGTACCCTACGCTCAAGTTCCTCGAGGAACTTGAGCGTAGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-714s21c1
Sequence:CCGGTGGTTCTCTTCAAGAAGTTTGCTCGAGCAAACTTCTTGAAGAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-1060s21c1
Sequence:CCGGGCGCTTGGTCAACCTTGAAACCTCGAGGTTTCAAGGTTGACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-845s21c1
Sequence:CCGGCAGACGTCTGCCAAGATCTTCCTCGAGGAAGATCTTGGCAGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006849
PDIA2 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1398s1c1
Sequence:CCGGAGGTCGGAAGGTGATTGAATACTCGAGTATTCAATCACCTTCCGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1397s1c1
Sequence:CCGGCAGGTCGGAAGGTGATTGAATCTCGAGATTCAATCACCTTCCGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1297s1c1
Sequence:CCGGCACGAGGACATCATCATTGCTCTCGAGAGCAATGATGATGTCCTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-398s21c1
Sequence:CCGGGAGTACCCTACGCTCAAGTTCCTCGAGGAACTTGAGCGTAGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-714s21c1
Sequence:CCGGTGGTTCTCTTCAAGAAGTTTGCTCGAGCAAACTTCTTGAAGAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-1060s21c1
Sequence:CCGGGCGCTTGGTCAACCTTGAAACCTCGAGGTTTCAAGGTTGACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-845s21c1
Sequence:CCGGCAGACGTCTGCCAAGATCTTCCTCGAGGAAGATCTTGGCAGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006849
PDIA2 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1398s1c1
Sequence:CCGGAGGTCGGAAGGTGATTGAATACTCGAGTATTCAATCACCTTCCGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1397s1c1
Sequence:CCGGCAGGTCGGAAGGTGATTGAATCTCGAGATTCAATCACCTTCCGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006849.x-1297s1c1
Sequence:CCGGCACGAGGACATCATCATTGCTCTCGAGAGCAATGATGATGTCCTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-398s21c1
Sequence:CCGGGAGTACCCTACGCTCAAGTTCCTCGAGGAACTTGAGCGTAGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-714s21c1
Sequence:CCGGTGGTTCTCTTCAAGAAGTTTGCTCGAGCAAACTTCTTGAAGAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-1060s21c1
Sequence:CCGGGCGCTTGGTCAACCTTGAAACCTCGAGGTTTCAAGGTTGACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006849.2-845s21c1
Sequence:CCGGCAGACGTCTGCCAAGATCTTCCTCGAGGAAGATCTTGGCAGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081070
PDIA2 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1373s21c1
Sequence:CCGGATCGTGAGGACATTGTCATTGCTCGAGCAATGACAATGTCCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1471s21c1
Sequence:CCGGGGGCCTGACCGAAAGGTTATACTCGAGTATAACCTTTCGGTCAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1397s21c1
Sequence:CCGGAGTTGGATGCTACAGCTAATGCTCGAGCATTAGCTGTAGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-857s21c1
Sequence:CCGGAGACATCACCTAAGATCTTTGCTCGAGCAAAGATCTTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1019s21c1
Sequence:CCGGACAGCCATGTGCTGAATTATTCTCGAGAATAATTCAGCACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081070
PDIA2 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1373s21c1
Sequence:CCGGATCGTGAGGACATTGTCATTGCTCGAGCAATGACAATGTCCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1471s21c1
Sequence:CCGGGGGCCTGACCGAAAGGTTATACTCGAGTATAACCTTTCGGTCAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1397s21c1
Sequence:CCGGAGTTGGATGCTACAGCTAATGCTCGAGCATTAGCTGTAGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-857s21c1
Sequence:CCGGAGACATCACCTAAGATCTTTGCTCGAGCAAAGATCTTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1019s21c1
Sequence:CCGGACAGCCATGTGCTGAATTATTCTCGAGAATAATTCAGCACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081070
PDIA2 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1373s21c1
Sequence:CCGGATCGTGAGGACATTGTCATTGCTCGAGCAATGACAATGTCCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1471s21c1
Sequence:CCGGGGGCCTGACCGAAAGGTTATACTCGAGTATAACCTTTCGGTCAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1397s21c1
Sequence:CCGGAGTTGGATGCTACAGCTAATGCTCGAGCATTAGCTGTAGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-857s21c1
Sequence:CCGGAGACATCACCTAAGATCTTTGCTCGAGCAAAGATCTTAGGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081070.1-1019s21c1
Sequence:CCGGACAGCCATGTGCTGAATTATTCTCGAGAATAATTCAGCACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks