EMAIL THIS PAGE TO A FRIEND

PDIA5

protein disulfide isomerase family A, member 5

Synonyms: PDIR
UniProtKB ID: Q14554, D3DN95
Gene ID:
Mouse(72599) protein disulfide isomerase associated 5
Rat(360722) protein disulfide isomerase family A, member 5
naked mole-rat(101701522) protein disulfide isomerase family A, member 5
domestic guinea pig(100715570) protein disulfide isomerase family A, member 5
cow(511603) protein disulfide isomerase family A, member 5
sheep(100302347) protein disulfide isomerase family A, member 5
Zebrafish(556162) protein disulfide isomerase family A, member 5
Horse(100070524) protein disulfide isomerase family A, member 5
chicken(424249) protein disulfide isomerase family A, member 5
domestic cat(101092636) protein disulfide isomerase family A, member 5
dog(478589) protein disulfide isomerase family A, member 5
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006810 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006810 Rosetta Predictions human pricing
NM_001014125 Rosetta Predictions rat pricing
NM_028295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231330 predicted 897
2 SASI_Hs02_00342340 predicted 386
3 SASI_Hs01_00231332 predicted 885
4 SASI_Hs01_00231333 predicted 601
5 SASI_Hs01_00231334 predicted 791
6 SASI_Hs01_00231335 predicted 614
7 SASI_Hs01_00231336 predicted 500
8 SASI_Hs01_00231337 predicted 674
9 SASI_Hs02_00342341 predicted 306
10 SASI_Hs01_00231338 predicted 287
11 SASI_Hs01_00231329 predicted 762
12 SASI_Hs01_00231331 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031918 predicted 511
2 SASI_Rn01_00031919 predicted 958
3 SASI_Rn01_00031920 predicted 469
4 SASI_Rn01_00031921 predicted 1054
5 SASI_Rn01_00031922 predicted 852
6 SASI_Rn01_00031923 predicted 1495
7 SASI_Rn01_00031924 predicted 868
8 SASI_Rn01_00031925 predicted 1063
9 SASI_Rn01_00031926 predicted 877
10 SASI_Rn01_00031927 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034597 predicted 1418
2 SASI_Mm01_00034598 predicted 232
3 SASI_Mm01_00034599 predicted 812
4 SASI_Mm01_00034600 predicted 575
5 SASI_Mm01_00034601 predicted 217
6 SASI_Mm01_00034602 predicted 928
7 SASI_Mm01_00034604 predicted 487
8 SASI_Mm02_00333645 predicted 205
9 SASI_Mm01_00034605 predicted 1464
10 SASI_Mm01_00034606 predicted 233
11 SASI_Mm01_00034603 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028295
VALIDATED
PDIA5 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-658s21c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-1381s21c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-780s21c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-736s21c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-736s1c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-658s1c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-1381s1c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-780s1c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-205s1c1
Sequence:CCGGCGACCCTAAGGACTTGAAGAACTCGAGTTCTTCAAGTCCTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028295
VALIDATED
PDIA5 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-658s21c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-1381s21c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-780s21c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-736s21c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-736s1c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-658s1c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-1381s1c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-780s1c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-205s1c1
Sequence:CCGGCGACCCTAAGGACTTGAAGAACTCGAGTTCTTCAAGTCCTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028295
VALIDATED
PDIA5 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-658s21c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-1381s21c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-780s21c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028295.1-736s21c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-736s1c1
Sequence:CCGGCCCATCAGAGTTCGAGAACATCTCGAGATGTTCTCGAACTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028295.1-658s1c1
Sequence:CCGGCAAGAGAATCATGCCACATTTCTCGAGAAATGTGGCATGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-1381s1c1
Sequence:CCGGCCCACACTGTAAGAAGGTCATCTCGAGATGACCTTCTTACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-780s1c1
Sequence:CCGGGCTACCCTACCATCTGCTATTCTCGAGAATAGCAGATGGTAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028295.1-205s1c1
Sequence:CCGGCGACCCTAAGGACTTGAAGAACTCGAGTTCTTCAAGTCCTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006810
VALIDATED
PDIA5 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1082s21c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-548s21c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1335s21c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-504s21c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-192s21c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1082s1c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-504s1c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1335s1c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-192s1c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-548s1c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006810
VALIDATED
PDIA5 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1082s21c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-548s21c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1335s21c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-504s21c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-192s21c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1082s1c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-504s1c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1335s1c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-192s1c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-548s1c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006810
VALIDATED
PDIA5 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1082s21c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-548s21c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-1335s21c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-504s21c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006810.2-192s21c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1082s1c1
Sequence:CCGGCCTGGCAGAAAGATTCCACATCTCGAGATGTGGAATCTTTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-504s1c1
Sequence:CCGGGCCAAAGATGTTGTCCACCTTCTCGAGAAGGTGGACAACATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-1335s1c1
Sequence:CCGGCCACACTGTAAGAAGGTCATTCTCGAGAATGACCTTCTTACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006810.1-192s1c1
Sequence:CCGGCGGAATAATGTACTGGTGCTTCTCGAGAAGCACCAGTACATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006810.1-548s1c1
Sequence:CCGGGCTCCTGAAGAAGGAAGAGAACTCGAGTTCTCTTCCTTCTTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks