EMAIL THIS PAGE TO A FRIEND

PDLIM5

PDZ and LIM domain 5

Synonyms: ENH ENH1 LIM
UniProtKB ID: Q96HC4, A8K6F9, O60705, Q56VN4, Q5UW38, Q8WVK0
Gene ID:
Human(10611) Summary: This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(56376) PDZ and LIM domain 5
Rat(64353) PDZ and LIM domain 5
cow(503621) PDZ and LIM domain 5
sheep(101114358) PDZ and LIM domain 5
Domestic Rabbit(100351774) PDZ and LIM domain 5
naked mole-rat(101707820) PDZ and LIM domain 5
domestic guinea pig(100732952) PDZ and LIM domain 5
chicken(422699) PDZ and LIM domain 5
Horse(100053510) PDZ and LIM domain 5
dog(478482) PDZ and LIM domain 5
domestic cat(101083080) PDZ and LIM domain 5
Gene Class: Cytoskeleton
307 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011513 Rosetta Predictions human pricing
NM_001011514 Rosetta Predictions human pricing
NM_001011515 Rosetta Predictions human pricing
NM_001011516 Rosetta Predictions human pricing
NM_006457 Rosetta Predictions human pricing
NR_003257 Rosetta Predictions human pricing
NM_053326 Rosetta Predictions rat pricing
XM_579553 Rosetta Predictions rat pricing
NM_019808 Rosetta Predictions mouse pricing
NM_019809 Rosetta Predictions mouse pricing
NM_022554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040006 predicted 1090
2 SASI_Hs02_00305963 predicted 700
3 SASI_Hs01_00040007 predicted 1012
4 SASI_Hs01_00040010 predicted 1342
5 SASI_Hs01_00040013 predicted 1281
6 SASI_Hs02_00305964 predicted 709
7 SASI_Hs02_00305965 predicted 1004
8 SASI_Hs02_00305966 predicted 1419
9 SASI_Hs02_00305967 predicted 1029
10 SASI_Hs02_00305968 predicted 1181
11 SASI_Hs01_00040005 predicted 1077
12 SASI_Hs01_00040008 predicted 1392
13 SASI_Hs01_00040009 predicted 989
14 SASI_Hs01_00040011 predicted 1020
15 SASI_Hs01_00040012 predicted 1081
16 SASI_Hs01_00040014 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192354 predicted 986
2 SASI_Hs01_00192355 predicted 817
3 SASI_Hs01_00192356 predicted 924
4 SASI_Hs01_00192357 predicted 986
5 SASI_Hs01_00192358 predicted 903
6 SASI_Hs01_00192359 predicted 934
7 SASI_Hs01_00192360 predicted 996
8 SASI_Hs01_00192361 predicted 921
9 SASI_Hs01_00192362 predicted 914
10 SASI_Hs01_00192363 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067774 predicted 1289
2 SASI_Hs01_00067775 predicted 1290
3 SASI_Hs02_00305969 predicted 826
4 SASI_Hs01_00067777 predicted 625
5 SASI_Hs01_00067778 predicted 724
6 SASI_Hs01_00067779 predicted 305
7 SASI_Hs01_00067780 predicted 543
8 SASI_Hs01_00067781 predicted 561
9 SASI_Hs01_00067782 predicted 363
10 SASI_Hs01_00067783 predicted 723
11 SASI_Hs01_00067776 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213313 predicted 1230
2 SASI_Hs01_00213314 predicted 1231
3 SASI_Hs02_00305970 predicted 761
4 SASI_Hs01_00213316 predicted 564
5 SASI_Hs01_00213317 predicted 666
6 SASI_Hs01_00213318 predicted 483
7 SASI_Hs01_00213319 predicted 503
8 SASI_Hs01_00213320 predicted 361
9 SASI_Hs01_00213321 predicted 664
10 SASI_Hs01_00213322 predicted 447
11 SASI_Hs01_00213315 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163326 predicted 1419
2 SASI_Hs02_00341600 predicted 1034
3 SASI_Hs01_00163327 predicted 1342
4 SASI_Hs01_00163330 predicted 1671
5 SASI_Hs01_00163333 predicted 1613
6 SASI_Hs02_00341601 predicted 1039
7 SASI_Hs02_00341602 predicted 1323
8 SASI_Hs02_00341603 predicted 1747
9 SASI_Hs02_00341604 predicted 1355
10 SASI_Hs02_00341605 predicted 1503
11 SASI_Hs01_00163325 predicted 1405
12 SASI_Hs01_00163328 predicted 1723
13 SASI_Hs01_00163329 predicted 1312
14 SASI_Hs01_00163331 predicted 1357
15 SASI_Hs01_00163332 predicted 1418
16 SASI_Hs01_00163334 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378957 predicted 3603
2 SASI_Hs02_00378958 predicted 1007
3 SASI_Hs02_00378959 predicted 3229
4 SASI_Hs02_00378960 predicted 607
5 SASI_Hs02_00378961 predicted 3187
6 SASI_Hs02_00378962 predicted 919
7 SASI_Hs02_00378963 predicted 1250
8 SASI_Hs02_00378964 predicted 455
9 SASI_Hs02_00378965 predicted 3485
10 SASI_Hs02_00378966 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074717 predicted 347
2 SASI_Rn01_00074718 predicted 408
3 SASI_Rn01_00074720 predicted 1153
4 SASI_Rn01_00074721 predicted 1370
5 SASI_Rn01_00074722 predicted 218
6 SASI_Rn01_00074723 predicted 270
7 SASI_Rn01_00074724 predicted 374
8 SASI_Rn01_00074725 predicted 654
9 SASI_Rn01_00074726 predicted 1434
10 SASI_Rn02_00265760 predicted 944
11 SASI_Rn01_00074719 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144818 predicted 264
2 SASI_Rn01_00144819 predicted 1293
3 SASI_Rn01_00144820 predicted 878
4 SASI_Rn01_00144821 predicted 1225
5 SASI_Rn01_00144822 predicted 265
6 SASI_Rn01_00144823 predicted 1006
7 SASI_Rn01_00144824 predicted 1268
8 SASI_Rn01_00144825 predicted 295
9 SASI_Rn01_00144826 predicted 230
10 SASI_Rn01_00144827 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131829 predicted 404
2 SASI_Mm02_00325070 predicted 346
3 SASI_Mm01_00131830 predicted 651
4 SASI_Mm02_00325071 predicted 347
5 SASI_Mm01_00131831 predicted 654
6 SASI_Mm01_00131832 predicted 402
7 SASI_Mm01_00131833 predicted 417
8 SASI_Mm01_00131834 predicted 396
9 SASI_Mm02_00325072 predicted 713
10 SASI_Mm01_00131835 predicted 399
11 SASI_Mm01_00131836 predicted 432
12 SASI_Mm01_00131837 predicted 657
13 SASI_Mm01_00131838 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325073 predicted 1037
2 SASI_Mm02_00325074 predicted 1099
3 SASI_Mm02_00325075 predicted 1062
4 SASI_Mm02_00325076 predicted 1106
5 SASI_Mm02_00325077 predicted 1121
6 SASI_Mm02_00325078 predicted 1069
7 SASI_Mm02_00325079 predicted 1034
8 SASI_Mm02_00325080 predicted 1043
9 SASI_Mm02_00325081 predicted 1109
10 SASI_Mm02_00325082 predicted 1124
11 SASI_Mm01_00148118 predicted 367
12 SASI_Mm01_00148119 predicted 614
13 SASI_Mm01_00148120 predicted 615
14 SASI_Mm01_00148121 predicted 359
15 SASI_Mm01_00148122 predicted 367
16 SASI_Mm01_00148123 predicted 353
17 SASI_Mm01_00148124 predicted 357
18 SASI_Mm01_00148125 predicted 430
19 SASI_Mm01_00148126 predicted 658
20 SASI_Mm01_00148127 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326613 predicted 711
2 SASI_Mm02_00326614 predicted 778
3 SASI_Mm02_00326615 predicted 732
4 SASI_Mm02_00326616 predicted 781
5 SASI_Mm02_00326617 predicted 795
6 SASI_Mm02_00326618 predicted 735
7 SASI_Mm02_00326619 predicted 704
8 SASI_Mm02_00326620 predicted 715
9 SASI_Mm02_00326621 predicted 787
10 SASI_Mm02_00326622 predicted 788
11 SASI_Mm01_00127959 predicted 755
12 SASI_Mm01_00127960 predicted 431
13 SASI_Mm01_00127961 predicted 544
14 SASI_Mm01_00127962 predicted 805
15 SASI_Mm01_00127963 predicted 544
16 SASI_Mm01_00127964 predicted 524
17 SASI_Mm01_00127965 predicted 525
18 SASI_Mm01_00127966 predicted 280
19 SASI_Mm01_00127967 predicted 277
20 SASI_Mm01_00127968 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019809
VALIDATED
PDLIM5 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-904s21c1
Sequence:CCGGACGACTCAGTCTCGTTCTTTCCTCGAGGAAAGAACGAGACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019809.2-1109s21c1
Sequence:CCGGACCTAAGCAGCTAGCACATACCTCGAGGTATGTGCTAGCTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-434s21c1
Sequence:CCGGCTACCAACATGGCCTACAATACTCGAGTATTGTAGGCCATGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-610s21c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-370s21c1
Sequence:CCGGGAACCTAAGGAAGTAGTTAAGCTCGAGCTTAACTACTTCCTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-272s1c1
Sequence:CCGGCCCAGAACAAGATTAAGGCTTCTCGAGAAGCCTTAATCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019809.1-610s1c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-761s1c1
Sequence:CCGGAGGGTGACATTAAGCAGCAAACTCGAGTTTGCTGCTTAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1009s1c1
Sequence:CCGGCTTCACGTCTTTAGTCCCAAACTCGAGTTTGGGACTAAAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1011s1c1
Sequence:CCGGTCACGTCTTTAGTCCCAAATACTCGAGTATTTGGGACTAAAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019809
VALIDATED
PDLIM5 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-904s21c1
Sequence:CCGGACGACTCAGTCTCGTTCTTTCCTCGAGGAAAGAACGAGACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019809.2-1109s21c1
Sequence:CCGGACCTAAGCAGCTAGCACATACCTCGAGGTATGTGCTAGCTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-434s21c1
Sequence:CCGGCTACCAACATGGCCTACAATACTCGAGTATTGTAGGCCATGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-610s21c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-370s21c1
Sequence:CCGGGAACCTAAGGAAGTAGTTAAGCTCGAGCTTAACTACTTCCTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-272s1c1
Sequence:CCGGCCCAGAACAAGATTAAGGCTTCTCGAGAAGCCTTAATCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019809.1-610s1c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-761s1c1
Sequence:CCGGAGGGTGACATTAAGCAGCAAACTCGAGTTTGCTGCTTAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1009s1c1
Sequence:CCGGCTTCACGTCTTTAGTCCCAAACTCGAGTTTGGGACTAAAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1011s1c1
Sequence:CCGGTCACGTCTTTAGTCCCAAATACTCGAGTATTTGGGACTAAAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019809
VALIDATED
PDLIM5 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-904s21c1
Sequence:CCGGACGACTCAGTCTCGTTCTTTCCTCGAGGAAAGAACGAGACTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019809.2-1109s21c1
Sequence:CCGGACCTAAGCAGCTAGCACATACCTCGAGGTATGTGCTAGCTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-434s21c1
Sequence:CCGGCTACCAACATGGCCTACAATACTCGAGTATTGTAGGCCATGTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-610s21c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019809.2-370s21c1
Sequence:CCGGGAACCTAAGGAAGTAGTTAAGCTCGAGCTTAACTACTTCCTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-272s1c1
Sequence:CCGGCCCAGAACAAGATTAAGGCTTCTCGAGAAGCCTTAATCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019809.1-610s1c1
Sequence:CCGGCTGCATGTTAGTGCCAATCTTCTCGAGAAGATTGGCACTAACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-761s1c1
Sequence:CCGGAGGGTGACATTAAGCAGCAAACTCGAGTTTGCTGCTTAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1009s1c1
Sequence:CCGGCTTCACGTCTTTAGTCCCAAACTCGAGTTTGGGACTAAAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019809.1-1011s1c1
Sequence:CCGGTCACGTCTTTAGTCCCAAATACTCGAGTATTTGGGACTAAAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006457
VALIDATED
PDLIM5 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1722s21c1
Sequence:CCGGCCTACTGTGAGACTGATTATTCTCGAGAATAATCAGTCTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1744s21c1
Sequence:CCGGTGCCCTCTTTGGTACTATATGCTCGAGCATATAGTACCAAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1039s21c1
Sequence:CCGGAGAATCTGAAGCCGATAATACCTCGAGGTATTATCGGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006457.3-2289s21c1
Sequence:CCGGTGTTAGGTAGTTATGAGTAAACTCGAGTTTACTCATAACTACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1411s21c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-376s1c1
Sequence:CCGGGAGAACCTAAAGAAGTAGTTACTCGAGTAACTACTTCTTTAGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1343s1c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1839s1c1
Sequence:CCGGCTGTGTAAGAAACATGCTCATCTCGAGATGAGCATGTTTCTTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-1475s1c1
Sequence:CCGGCCTGTATTGTGAGCTGTGCTACTCGAGTAGCACAGCTCACAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-280s1c1
Sequence:CCGGCCCAGAATAAGATTAAGGGTTCTCGAGAACCCTTAATCTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006457
VALIDATED
PDLIM5 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1722s21c1
Sequence:CCGGCCTACTGTGAGACTGATTATTCTCGAGAATAATCAGTCTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1744s21c1
Sequence:CCGGTGCCCTCTTTGGTACTATATGCTCGAGCATATAGTACCAAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1039s21c1
Sequence:CCGGAGAATCTGAAGCCGATAATACCTCGAGGTATTATCGGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006457.3-2289s21c1
Sequence:CCGGTGTTAGGTAGTTATGAGTAAACTCGAGTTTACTCATAACTACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1411s21c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-376s1c1
Sequence:CCGGGAGAACCTAAAGAAGTAGTTACTCGAGTAACTACTTCTTTAGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1343s1c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1839s1c1
Sequence:CCGGCTGTGTAAGAAACATGCTCATCTCGAGATGAGCATGTTTCTTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-1475s1c1
Sequence:CCGGCCTGTATTGTGAGCTGTGCTACTCGAGTAGCACAGCTCACAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-280s1c1
Sequence:CCGGCCCAGAATAAGATTAAGGGTTCTCGAGAACCCTTAATCTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006457
VALIDATED
PDLIM5 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1722s21c1
Sequence:CCGGCCTACTGTGAGACTGATTATTCTCGAGAATAATCAGTCTCACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1744s21c1
Sequence:CCGGTGCCCTCTTTGGTACTATATGCTCGAGCATATAGTACCAAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1039s21c1
Sequence:CCGGAGAATCTGAAGCCGATAATACCTCGAGGTATTATCGGCTTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006457.3-2289s21c1
Sequence:CCGGTGTTAGGTAGTTATGAGTAAACTCGAGTTTACTCATAACTACCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006457.3-1411s21c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-376s1c1
Sequence:CCGGGAGAACCTAAAGAAGTAGTTACTCGAGTAACTACTTCTTTAGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1343s1c1
Sequence:CCGGCGCCCATTGTAACCAGGTCATCTCGAGATGACCTGGTTACAATGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006457.1-1839s1c1
Sequence:CCGGCTGTGTAAGAAACATGCTCATCTCGAGATGAGCATGTTTCTTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-1475s1c1
Sequence:CCGGCCTGTATTGTGAGCTGTGCTACTCGAGTAGCACAGCTCACAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006457.1-280s1c1
Sequence:CCGGCCCAGAATAAGATTAAGGGTTCTCGAGAACCCTTAATCTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks