EMAIL THIS PAGE TO A FRIEND

PEX11A

peroxisomal biogenesis factor 11 alpha

Synonyms: PEX11-ALPHA PMP28 hsPEX11p
UniProtKB ID: O75192
Gene ID:
Human(8800) Summary: This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Mouse(18631) peroxisomal biogenesis factor 11 alpha
Rat(85249) peroxisomal biogenesis factor 11 alpha
Thale Cress(841186) peroxisomal membrane protein 11A
Zebrafish(565760) peroxisomal biogenesis factor 11 alpha
chicken(415486) peroxisomal biogenesis factor 11 alpha
domestic cat(101083084) peroxisomal biogenesis factor 11 alpha
dog(488736) peroxisomal biogenesis factor 11 alpha
cow(515608) peroxisomal biogenesis factor 11 alpha
sheep(101104182) peroxisomal biogenesis factor 11 alpha
naked mole-rat(101703616) peroxisomal biogenesis factor 11 alpha
domestic guinea pig(100730567) peroxisomal biogenesis factor 11 alpha
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003847 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003847 Rosetta Predictions human pricing
NM_053487 Rosetta Predictions rat pricing
NM_011068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037879 predicted 245
2 SASI_Hs01_00037880 predicted 683
3 SASI_Hs01_00037882 predicted 339
4 SASI_Hs01_00037883 predicted 611
5 SASI_Hs01_00037884 predicted 821
6 SASI_Hs01_00037885 predicted 295
7 SASI_Hs01_00037886 predicted 892
8 SASI_Hs01_00037887 predicted 356
9 SASI_Hs01_00037888 predicted 493
10 SASI_Hs02_00336421 predicted 272
11 SASI_Hs01_00037881 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112681 predicted 1313
2 SASI_Rn01_00112682 predicted 368
3 SASI_Rn01_00112683 predicted 1212
4 SASI_Rn01_00112685 predicted 266
5 SASI_Rn01_00112686 predicted 399
6 SASI_Rn01_00112687 predicted 422
7 SASI_Rn01_00112688 predicted 253
8 SASI_Rn01_00112689 predicted 290
9 SASI_Rn01_00112690 predicted 521
10 SASI_Rn02_00266087 predicted 420
11 SASI_Rn01_00112684 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042682 predicted 353
2 SASI_Mm01_00042683 predicted 384
3 SASI_Mm01_00042684 predicted 597
4 SASI_Mm01_00042685 predicted 547
5 SASI_Mm01_00042686 predicted 237
6 SASI_Mm01_00042687 predicted 205
7 SASI_Mm01_00042688 predicted 337
8 SASI_Mm01_00042689 predicted 229
9 SASI_Mm01_00042690 predicted 368
10 SASI_Mm01_00042691 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011068
VALIDATED
PEX11A MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 11 alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-213s21c1
Sequence:CCGGTGTGAGCACTGGCCGTAAATGCTCGAGCATTTACGGCCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-327s21c1
Sequence:CCGGCAACCTCAACCGCGTGGTTTACTCGAGTAAACCACGCGGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011068.1-468s21c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-550s21c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-130s21c1
Sequence:CCGGGCATGCATGTTGCTTAGATATCTCGAGATATCTAAGCAACATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-315s1c1
Sequence:CCGGCCTGACATTAGCCAACCTCAACTCGAGTTGAGGTTGGCTAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-690s1c1
Sequence:CCGGGCTTGGGATCTACAAGTCCAACTCGAGTTGGACTTGTAGATCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-468s1c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-129s1c1
Sequence:CCGGCGCATGCATGTTGCTTAGATACTCGAGTATCTAAGCAACATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-550s1c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011068
VALIDATED
PEX11A MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 11 alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-213s21c1
Sequence:CCGGTGTGAGCACTGGCCGTAAATGCTCGAGCATTTACGGCCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-327s21c1
Sequence:CCGGCAACCTCAACCGCGTGGTTTACTCGAGTAAACCACGCGGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011068.1-468s21c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-550s21c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-130s21c1
Sequence:CCGGGCATGCATGTTGCTTAGATATCTCGAGATATCTAAGCAACATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-315s1c1
Sequence:CCGGCCTGACATTAGCCAACCTCAACTCGAGTTGAGGTTGGCTAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-690s1c1
Sequence:CCGGGCTTGGGATCTACAAGTCCAACTCGAGTTGGACTTGTAGATCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-468s1c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-129s1c1
Sequence:CCGGCGCATGCATGTTGCTTAGATACTCGAGTATCTAAGCAACATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-550s1c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011068
VALIDATED
PEX11A MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 11 alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-213s21c1
Sequence:CCGGTGTGAGCACTGGCCGTAAATGCTCGAGCATTTACGGCCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-327s21c1
Sequence:CCGGCAACCTCAACCGCGTGGTTTACTCGAGTAAACCACGCGGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011068.1-468s21c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-550s21c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011068.1-130s21c1
Sequence:CCGGGCATGCATGTTGCTTAGATATCTCGAGATATCTAAGCAACATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-315s1c1
Sequence:CCGGCCTGACATTAGCCAACCTCAACTCGAGTTGAGGTTGGCTAATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-690s1c1
Sequence:CCGGGCTTGGGATCTACAAGTCCAACTCGAGTTGGACTTGTAGATCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011068.1-468s1c1
Sequence:CCGGCCGGGATCTGTATGAGATCTTCTCGAGAAGATCTCATACAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-129s1c1
Sequence:CCGGCGCATGCATGTTGCTTAGATACTCGAGTATCTAAGCAACATGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011068.1-550s1c1
Sequence:CCGGCCTAAGTACAGCGTGGCTAATCTCGAGATTAGCCACGCTGTACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003847
VALIDATED
PEX11A MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 11 alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-303s21c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-463s21c1
Sequence:CCGGCTGCTCACCACTACTACTATTCTCGAGAATAGTAGTAGTGGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003847.1-818s21c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-941s21c1
Sequence:CCGGCTTGTTCATGTGAGCATTTAACTCGAGTTAAATGCTCACATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-248s21c1
Sequence:CCGGTGTGAGCACTGGTCGTAAATGCTCGAGCATTTACGACCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-919s1c1
Sequence:CCGGCATGTCATACTGTGCTTCCTTCTCGAGAAGGAAGCACAGTATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003847.1-1005s1c1
Sequence:CCGGGAGGAGCATGAAGAGTTGTATCTCGAGATACAACTCTTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-851s1c1
Sequence:CCGGGCTTGGAACTAGTACCTACTTCTCGAGAAGTAGGTACTAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-523s1c1
Sequence:CCGGCCCTGCAGATGAAACGAGTTACTCGAGTAACTCGTTTCATCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-303s1c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-818s1c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003847
VALIDATED
PEX11A MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 11 alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-303s21c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-463s21c1
Sequence:CCGGCTGCTCACCACTACTACTATTCTCGAGAATAGTAGTAGTGGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003847.1-818s21c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-941s21c1
Sequence:CCGGCTTGTTCATGTGAGCATTTAACTCGAGTTAAATGCTCACATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-248s21c1
Sequence:CCGGTGTGAGCACTGGTCGTAAATGCTCGAGCATTTACGACCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-919s1c1
Sequence:CCGGCATGTCATACTGTGCTTCCTTCTCGAGAAGGAAGCACAGTATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003847.1-1005s1c1
Sequence:CCGGGAGGAGCATGAAGAGTTGTATCTCGAGATACAACTCTTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-851s1c1
Sequence:CCGGGCTTGGAACTAGTACCTACTTCTCGAGAAGTAGGTACTAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-523s1c1
Sequence:CCGGCCCTGCAGATGAAACGAGTTACTCGAGTAACTCGTTTCATCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-303s1c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-818s1c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003847
VALIDATED
PEX11A MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 11 alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-303s21c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-463s21c1
Sequence:CCGGCTGCTCACCACTACTACTATTCTCGAGAATAGTAGTAGTGGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003847.1-818s21c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-941s21c1
Sequence:CCGGCTTGTTCATGTGAGCATTTAACTCGAGTTAAATGCTCACATGAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003847.1-248s21c1
Sequence:CCGGTGTGAGCACTGGTCGTAAATGCTCGAGCATTTACGACCAGTGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-919s1c1
Sequence:CCGGCATGTCATACTGTGCTTCCTTCTCGAGAAGGAAGCACAGTATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003847.1-1005s1c1
Sequence:CCGGGAGGAGCATGAAGAGTTGTATCTCGAGATACAACTCTTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-851s1c1
Sequence:CCGGGCTTGGAACTAGTACCTACTTCTCGAGAAGTAGGTACTAGTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-523s1c1
Sequence:CCGGCCCTGCAGATGAAACGAGTTACTCGAGTAACTCGTTTCATCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-303s1c1
Sequence:CCGGGCAACTGAGCAGAGCATTCATCTCGAGATGAATGCTCTGCTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003847.1-818s1c1
Sequence:CCGGGATGAAGCTGAAGACCCGTTACTCGAGTAACGGGTCTTCAGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks