EMAIL THIS PAGE TO A FRIEND

PEX13

peroxisomal biogenesis factor 13

Synonyms: NALD PBD11A PBD11B ZWS
UniProtKB ID: Q92968, B2RCS1
Gene ID:
Human(5194) Summary: This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]
Mouse(72129) peroxisomal biogenesis factor 13
Rat(305581) peroxisomal biogenesis factor 13
fruit fly(36462) Peroxin 13
Thale Cress(819945) peroxin 13
chicken(421197) peroxisomal biogenesis factor 13
dog(474607) peroxisomal biogenesis factor 13
domestic cat(101100046) peroxisomal biogenesis factor 13
Zebrafish(393618) peroxisome biogenesis factor 13
cow(540337) peroxisomal biogenesis factor 13
sheep(101118094) peroxisomal biogenesis factor 13
Domestic Rabbit(100344212) peroxisomal biogenesis factor 13
naked mole-rat(101700640) peroxisomal biogenesis factor 13
domestic guinea pig(100719121) peroxisomal biogenesis factor 13
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002618 Rosetta Predictions human pricing
NM_001107242 Rosetta Predictions rat pricing
NM_023651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237336 predicted 297
2 SASI_Hs01_00237337 predicted 584
3 SASI_Hs02_00334132 predicted 259
4 SASI_Hs02_00334133 predicted 1115
5 SASI_Hs01_00237338 predicted 1296
6 SASI_Hs01_00237339 predicted 334
7 SASI_Hs01_00237342 predicted 363
8 SASI_Hs01_00237343 predicted 574
9 SASI_Hs01_00237344 predicted 458
10 SASI_Hs01_00237345 predicted 493
11 SASI_Hs01_00237340 predicted 1227
12 SASI_Hs01_00237341 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226915 predicted 400
2 SASI_Rn02_00226916 predicted 1359
3 SASI_Rn02_00226917 predicted 383
4 SASI_Rn02_00226918 predicted 604
5 SASI_Rn02_00226919 predicted 304
6 SASI_Rn02_00226920 predicted 759
7 SASI_Rn02_00226921 predicted 1013
8 SASI_Rn02_00226922 predicted 1290
9 SASI_Rn02_00226923 predicted 308
10 SASI_Rn02_00226924 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327261 predicted 808
2 SASI_Mm02_00327262 predicted 1125
3 SASI_Mm02_00327263 predicted 399
4 SASI_Mm02_00327264 predicted 389
5 SASI_Mm02_00327265 predicted 634
6 SASI_Mm02_00327266 predicted 1128
7 SASI_Mm02_00327267 predicted 1370
8 SASI_Mm02_00327268 predicted 531
9 SASI_Mm02_00327269 predicted 383
10 SASI_Mm02_00327270 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002618
VALIDATED
PEX13 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-483s21c1
Sequence:CCGGGAAAGTATTGTGCATGCATTTCTCGAGAAATGCATGCACAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-1053s21c1
Sequence:CCGGGGACTTATACCTGCGAATTATCTCGAGATAATTCGCAGGTATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002618.3-1387s21c1
Sequence:CCGGACATTTGTTATTGGCTATTTCCTCGAGGAAATAGCCAATAACAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-180s21c1
Sequence:CCGGGCTGATTTGGGTCCTACTTTACTCGAGTAAAGTAGGACCCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002618.2-1510s1c1
Sequence:CCGGCTAGGTTTATTGGAAGAGTAACTCGAGTTACTCTTCCAATAAACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-590s1c1
Sequence:CCGGCGGTATCTTTACAGACGGCTACTCGAGTAGCCGTCTGTAAAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1050s1c1
Sequence:CCGGCGGTGGAATCAAGTAAAGTTTCTCGAGAAACTTTACTTGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1193s1c1
Sequence:CCGGGCACCTGATTCCATTGGGAAACTCGAGTTTCCCAATGGAATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1203s1c1
Sequence:CCGGCCATTGGGAAAGATGGAGAAACTCGAGTTTCTCCATCTTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002618
VALIDATED
PEX13 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-483s21c1
Sequence:CCGGGAAAGTATTGTGCATGCATTTCTCGAGAAATGCATGCACAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-1053s21c1
Sequence:CCGGGGACTTATACCTGCGAATTATCTCGAGATAATTCGCAGGTATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002618.3-1387s21c1
Sequence:CCGGACATTTGTTATTGGCTATTTCCTCGAGGAAATAGCCAATAACAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-180s21c1
Sequence:CCGGGCTGATTTGGGTCCTACTTTACTCGAGTAAAGTAGGACCCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002618.2-1510s1c1
Sequence:CCGGCTAGGTTTATTGGAAGAGTAACTCGAGTTACTCTTCCAATAAACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-590s1c1
Sequence:CCGGCGGTATCTTTACAGACGGCTACTCGAGTAGCCGTCTGTAAAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1050s1c1
Sequence:CCGGCGGTGGAATCAAGTAAAGTTTCTCGAGAAACTTTACTTGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1193s1c1
Sequence:CCGGGCACCTGATTCCATTGGGAAACTCGAGTTTCCCAATGGAATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1203s1c1
Sequence:CCGGCCATTGGGAAAGATGGAGAAACTCGAGTTTCTCCATCTTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002618
VALIDATED
PEX13 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-483s21c1
Sequence:CCGGGAAAGTATTGTGCATGCATTTCTCGAGAAATGCATGCACAATACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-1053s21c1
Sequence:CCGGGGACTTATACCTGCGAATTATCTCGAGATAATTCGCAGGTATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002618.3-1387s21c1
Sequence:CCGGACATTTGTTATTGGCTATTTCCTCGAGGAAATAGCCAATAACAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002618.3-180s21c1
Sequence:CCGGGCTGATTTGGGTCCTACTTTACTCGAGTAAAGTAGGACCCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002618.2-1510s1c1
Sequence:CCGGCTAGGTTTATTGGAAGAGTAACTCGAGTTACTCTTCCAATAAACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-590s1c1
Sequence:CCGGCGGTATCTTTACAGACGGCTACTCGAGTAGCCGTCTGTAAAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1050s1c1
Sequence:CCGGCGGTGGAATCAAGTAAAGTTTCTCGAGAAACTTTACTTGATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1193s1c1
Sequence:CCGGGCACCTGATTCCATTGGGAAACTCGAGTTTCCCAATGGAATCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002618.2-1203s1c1
Sequence:CCGGCCATTGGGAAAGATGGAGAAACTCGAGTTTCTCCATCTTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023651
VALIDATED
PEX13 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 13
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-821s21c1
Sequence:CCGGGTTATCCTTGGCGGTCCTTATCTCGAGATAAGGACCGCCAAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-381s21c1
Sequence:CCGGCTTATAGTTATGGATACAATGCTCGAGCATTGTATCCATAACTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c1
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-371s1c1
Sequence:CCGGAGCTATAGCCCTTATAGTTATCTCGAGATAACTATAAGGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c2
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-642s21c1
Sequence:CCGGTTGCATTAGTTAGGACTATAACTCGAGTTATAGTCCTAACTAATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-976s21c1
Sequence:CCGGCCGTGCTGGTGATATGCTAAACTCGAGTTTAGCATATCACCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023651.4-1565s21c1
Sequence:CCGGATCTCAGTCCCTAGGCTTATTCTCGAGAATAAGCCTAGGGACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-1042s21c1
Sequence:CCGGGGCTAGTCTTGACGGTCAAACCTCGAGGTTTGACCGTCAAGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.2-181s1c1
Sequence:CCGGCACTTACCAATCTGCTGATTTCTCGAGAAATCAGCAGATTGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023651.2-3853s1c1
Sequence:CCGGGCTAATAACAAGAAGAGTGTTCTCGAGAACACTCTTCTTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.2-1265s1c1
Sequence:CCGGGCACCTGATTCTACAGGGAAACTCGAGTTTCCCTGTAGAATCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023651
VALIDATED
PEX13 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 13
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-821s21c1
Sequence:CCGGGTTATCCTTGGCGGTCCTTATCTCGAGATAAGGACCGCCAAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-381s21c1
Sequence:CCGGCTTATAGTTATGGATACAATGCTCGAGCATTGTATCCATAACTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c1
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-371s1c1
Sequence:CCGGAGCTATAGCCCTTATAGTTATCTCGAGATAACTATAAGGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c2
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-642s21c1
Sequence:CCGGTTGCATTAGTTAGGACTATAACTCGAGTTATAGTCCTAACTAATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-976s21c1
Sequence:CCGGCCGTGCTGGTGATATGCTAAACTCGAGTTTAGCATATCACCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023651.4-1565s21c1
Sequence:CCGGATCTCAGTCCCTAGGCTTATTCTCGAGAATAAGCCTAGGGACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-1042s21c1
Sequence:CCGGGGCTAGTCTTGACGGTCAAACCTCGAGGTTTGACCGTCAAGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.2-181s1c1
Sequence:CCGGCACTTACCAATCTGCTGATTTCTCGAGAAATCAGCAGATTGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023651.2-3853s1c1
Sequence:CCGGGCTAATAACAAGAAGAGTGTTCTCGAGAACACTCTTCTTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.2-1265s1c1
Sequence:CCGGGCACCTGATTCTACAGGGAAACTCGAGTTTCCCTGTAGAATCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023651
VALIDATED
PEX13 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 13
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-821s21c1
Sequence:CCGGGTTATCCTTGGCGGTCCTTATCTCGAGATAAGGACCGCCAAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-381s21c1
Sequence:CCGGCTTATAGTTATGGATACAATGCTCGAGCATTGTATCCATAACTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c1
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-371s1c1
Sequence:CCGGAGCTATAGCCCTTATAGTTATCTCGAGATAACTATAAGGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.4-339s1c2
Sequence:CCGGGATATGGAGCCTACGGAAATTCTCGAGAATTTCCGTAGGCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-642s21c1
Sequence:CCGGTTGCATTAGTTAGGACTATAACTCGAGTTATAGTCCTAACTAATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-976s21c1
Sequence:CCGGCCGTGCTGGTGATATGCTAAACTCGAGTTTAGCATATCACCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023651.4-1565s21c1
Sequence:CCGGATCTCAGTCCCTAGGCTTATTCTCGAGAATAAGCCTAGGGACTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023651.4-1042s21c1
Sequence:CCGGGGCTAGTCTTGACGGTCAAACCTCGAGGTTTGACCGTCAAGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_023651.2-181s1c1
Sequence:CCGGCACTTACCAATCTGCTGATTTCTCGAGAAATCAGCAGATTGGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023651.2-3853s1c1
Sequence:CCGGGCTAATAACAAGAAGAGTGTTCTCGAGAACACTCTTCTTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023651.2-1265s1c1
Sequence:CCGGGCACCTGATTCTACAGGGAAACTCGAGTTTCCCTGTAGAATCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks