EMAIL THIS PAGE TO A FRIEND

PFAS

phosphoribosylformylglycinamidine synthase

Synonyms: FGAMS FGARAT PURL
UniProtKB ID: O15067, A6H8V8
Gene ID:
Human(5198) Summary: Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(237823) phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Rat(287420) phosphoribosylformylglycinamidine synthase
Zebrafish(570437) phosphoribosylformylglycinamidine synthase
dog(489490) phosphoribosylformylglycinamidine synthase
domestic cat(101081508) phosphoribosylformylglycinamidine synthase
Horse(100062488) phosphoribosylformylglycinamidine synthase
domestic guinea pig(100730059) phosphoribosylformylglycinamidine synthase
Domestic Rabbit(100341557) phosphoribosylformylglycinamidine synthase
naked mole-rat(101715643) phosphoribosylformylglycinamidine synthase
cow(520318) phosphoribosylformylglycinamidine synthase
sheep(101122962) phosphoribosylformylglycinamidine synthase
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001159519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001159519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001159519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012393 Rosetta Predictions human pricing
NM_001105791 Rosetta Predictions rat pricing
XM_111232 Rosetta Predictions mouse pricing
XM_908501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126898 predicted 261
2 SASI_Hs01_00126899 predicted 907
3 SASI_Hs01_00126900 predicted 276
4 SASI_Hs01_00126901 predicted 3307
5 SASI_Hs01_00126902 predicted 2352
6 SASI_Hs01_00126903 predicted 4069
7 SASI_Hs01_00126904 predicted 2379
8 SASI_Hs01_00126905 predicted 1245
9 SASI_Hs01_00126906 predicted 3401
10 SASI_Hs01_00126907 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212566 predicted 3303
2 SASI_Rn02_00212567 predicted 1687
3 SASI_Rn02_00212568 predicted 3664
4 SASI_Rn02_00212569 predicted 578
5 SASI_Rn02_00212570 predicted 636
6 SASI_Rn02_00212571 predicted 1124
7 SASI_Rn02_00212572 predicted 1734
8 SASI_Rn02_00212573 predicted 4153
9 SASI_Rn02_00212574 predicted 1233
10 SASI_Rn02_00212575 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_111232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263299 predicted 461
2 SASI_Mm01_00263300 predicted 661
3 SASI_Mm01_00263301 predicted 1759
4 SASI_Mm01_00263302 predicted 3335
5 SASI_Mm01_00263303 predicted 457
6 SASI_Mm01_00263304 predicted 2606
7 SASI_Mm01_00263305 predicted 1355
8 SASI_Mm02_00424017 predicted 1205
9 SASI_Mm01_00263307 predicted 1958
10 SASI_Mm01_00263308 predicted 3065
11 SASI_Mm01_00263306 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434164 predicted 466
2 SASI_Mm02_00434165 predicted 662
3 SASI_Mm02_00434166 predicted 1761
4 SASI_Mm02_00434167 predicted 3333
5 SASI_Mm02_00434168 predicted 455
6 SASI_Mm02_00434169 predicted 2610
7 SASI_Mm02_00434170 predicted 1359
8 SASI_Mm02_00434171 predicted 1203
9 SASI_Mm02_00434172 predicted 1952
10 SASI_Mm02_00434173 predicted 3071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012393
VALIDATED
PFAS MISSION shRNA Bacterial Glycerol Stock
phosphoribosylformylglycinamidine synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-4072s1c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1241s1c1
Sequence:CCGGGTTGCCATTGAAGCCAGTAATCTCGAGATTACTGGCTTCAATGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012393.1-907s1c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1432s1c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-208s1c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4291s21c1
Sequence:CCGGATCTCAGCGGACTCGATAATCCTCGAGGATTATCGAGTCCGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-948s21c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-249s21c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-1473s21c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4113s21c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012393
VALIDATED
PFAS MISSION shRNA shRNA Plasmid DNA
phosphoribosylformylglycinamidine synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-4072s1c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1241s1c1
Sequence:CCGGGTTGCCATTGAAGCCAGTAATCTCGAGATTACTGGCTTCAATGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012393.1-907s1c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1432s1c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-208s1c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4291s21c1
Sequence:CCGGATCTCAGCGGACTCGATAATCCTCGAGGATTATCGAGTCCGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-948s21c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-249s21c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-1473s21c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4113s21c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012393
VALIDATED
PFAS MISSION shRNA Lentiviral Transduction Particles
phosphoribosylformylglycinamidine synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-4072s1c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1241s1c1
Sequence:CCGGGTTGCCATTGAAGCCAGTAATCTCGAGATTACTGGCTTCAATGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012393.1-907s1c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-1432s1c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012393.1-208s1c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4291s21c1
Sequence:CCGGATCTCAGCGGACTCGATAATCCTCGAGGATTATCGAGTCCGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-948s21c1
Sequence:CCGGCTGTGATAACAGCAGTGCAATCTCGAGATTGCACTGCTGTTATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-249s21c1
Sequence:CCGGCGAGACTGAACTGTGCTACAACTCGAGTTGTAGCACAGTTCAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-1473s21c1
Sequence:CCGGGCCAGGCATGGAAGTTGTAAACTCGAGTTTACAACTTCCATGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012393.2-4113s21c1
Sequence:CCGGGCTCTTTATCAATGCCCGAAACTCGAGTTTCGGGCATTGATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159519
PFAS MISSION shRNA Bacterial Glycerol Stock
phosphoribosylformylglycinamidine synthase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-461s21c1
Sequence:CCGGGACGTTACCGACTTTCGTTTACTCGAGTAAACGAAAGTCGGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-330s21c1
Sequence:CCGGTGTTCCTGGCTCCAACGATTTCTCGAGAAATCGTTGGAGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-771s21c1
Sequence:CCGGTAGTGAGCACAGCCGACATTGCTCGAGCAATGTCGGCTGTGCTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-1155s21c1
Sequence:CCGGCCTGCACATCCCAGATTATAACTCGAGTTATAATCTGGGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159519.1-4389s21c1
Sequence:CCGGTCGCCTTGTGATCCTTCATTCCTCGAGGAATGAAGGATCACAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159519
PFAS MISSION shRNA shRNA Plasmid DNA
phosphoribosylformylglycinamidine synthase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-461s21c1
Sequence:CCGGGACGTTACCGACTTTCGTTTACTCGAGTAAACGAAAGTCGGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-330s21c1
Sequence:CCGGTGTTCCTGGCTCCAACGATTTCTCGAGAAATCGTTGGAGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-771s21c1
Sequence:CCGGTAGTGAGCACAGCCGACATTGCTCGAGCAATGTCGGCTGTGCTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-1155s21c1
Sequence:CCGGCCTGCACATCCCAGATTATAACTCGAGTTATAATCTGGGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159519.1-4389s21c1
Sequence:CCGGTCGCCTTGTGATCCTTCATTCCTCGAGGAATGAAGGATCACAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159519
PFAS MISSION shRNA Lentiviral Transduction Particles
phosphoribosylformylglycinamidine synthase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-461s21c1
Sequence:CCGGGACGTTACCGACTTTCGTTTACTCGAGTAAACGAAAGTCGGTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-330s21c1
Sequence:CCGGTGTTCCTGGCTCCAACGATTTCTCGAGAAATCGTTGGAGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-771s21c1
Sequence:CCGGTAGTGAGCACAGCCGACATTGCTCGAGCAATGTCGGCTGTGCTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159519.1-1155s21c1
Sequence:CCGGCCTGCACATCCCAGATTATAACTCGAGTTATAATCTGGGATGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001159519.1-4389s21c1
Sequence:CCGGTCGCCTTGTGATCCTTCATTCCTCGAGGAATGAAGGATCACAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks