EMAIL THIS PAGE TO A FRIEND

PFKFB2

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2

Synonyms: PFK-2/FBPase-2
UniProtKB ID: O60825, O60824, Q5VVQ3, Q5VVQ4, Q9H3P1
Gene ID:
Human(5208) Summary: The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18640) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Rat(24640) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
naked mole-rat(101722273) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
domestic guinea pig(100713857) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
cow(287019) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
sheep(101119324) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
chicken(419850) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
domestic cat(101089572) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Horse(100051146) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
dog(480011) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502180 Anti-6-Phosphofructo-2-Kinase, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4502179 Anti-Fructose 6 Phosphate Kinase antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB1300480 Anti-PFKFB2 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300479 Anti-PFKFB2 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1406248 Anti-PFKFB2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA049975 Anti-PFKFB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2107203 Anti-PFKFB2 antibody produced in rabbit affinity isolated antibody horse, mouse, human, rabbit, guinea pig
ELISA, western blot pricing
SAB2107204 Anti-PFKFB2 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, mouse, guinea pig
ELISA, western blot pricing
HPA063575 Anti-PFKFB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504072 Anti-phospho-Fructose 6 Phosphate Kinase (pSer483) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018053 Rosetta Predictions human pricing
NM_006212 Rosetta Predictions human pricing
NM_001033964 Rosetta Predictions rat pricing
NM_001033965 Rosetta Predictions rat pricing
NM_080477 Rosetta Predictions rat pricing
NM_008825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069884 predicted 529
2 SASI_Hs01_00069885 predicted 394
3 SASI_Hs01_00069886 predicted 623
4 SASI_Hs02_00306940 predicted 464
5 SASI_Hs01_00069888 predicted 573
6 SASI_Hs01_00069889 predicted 1162
7 SASI_Hs01_00069890 predicted 1155
8 SASI_Hs01_00069891 predicted 1083
9 SASI_Hs01_00069892 predicted 707
10 SASI_Hs01_00069893 predicted 809
11 SASI_Hs01_00069887 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161385 predicted 523
2 SASI_Hs01_00161386 predicted 400
3 SASI_Hs01_00161387 predicted 617
4 SASI_Hs02_00341121 predicted 472
5 SASI_Hs01_00161389 predicted 575
6 SASI_Hs01_00161390 predicted 1161
7 SASI_Hs01_00161391 predicted 1156
8 SASI_Hs01_00161392 predicted 1085
9 SASI_Hs01_00161393 predicted 714
10 SASI_Hs01_00161394 predicted 813
11 SASI_Hs01_00161388 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092017 predicted 639
2 SASI_Rn01_00092018 predicted 395
3 SASI_Rn01_00092019 predicted 487
4 SASI_Rn01_00092020 predicted 406
5 SASI_Rn01_00092021 predicted 1195
6 SASI_Rn01_00092022 predicted 778
7 SASI_Rn01_00092023 predicted 895
8 SASI_Rn01_00092024 predicted 1254
9 SASI_Rn01_00092025 predicted 1243
10 SASI_Rn01_00092026 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098778 predicted 646
2 SASI_Rn01_00098779 predicted 388
3 SASI_Rn01_00098780 predicted 487
4 SASI_Rn01_00098781 predicted 401
5 SASI_Rn01_00098782 predicted 1197
6 SASI_Rn01_00098783 predicted 782
7 SASI_Rn01_00098784 predicted 897
8 SASI_Rn01_00098785 predicted 1253
9 SASI_Rn01_00098786 predicted 1240
10 SASI_Rn01_00098787 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044057 predicted 642
2 SASI_Rn01_00044058 predicted 387
3 SASI_Rn01_00044059 predicted 485
4 SASI_Rn01_00044060 predicted 402
5 SASI_Rn01_00044061 predicted 1192
6 SASI_Rn01_00044062 predicted 777
7 SASI_Rn01_00044063 predicted 895
8 SASI_Rn01_00044064 predicted 1249
9 SASI_Rn01_00044065 predicted 1248
10 SASI_Rn01_00044066 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182500 predicted 614
2 SASI_Mm01_00182501 predicted 363
3 SASI_Mm01_00182502 predicted 762
4 SASI_Mm01_00182503 predicted 1076
5 SASI_Mm01_00182504 predicted 403
6 SASI_Mm01_00182505 predicted 780
7 SASI_Mm01_00182506 predicted 1335
8 SASI_Mm01_00182507 predicted 1156
9 SASI_Mm01_00182508 predicted 740
10 SASI_Mm01_00182509 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008825
VALIDATED
PFKFB2 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-1704s21c1
Sequence:CCGGCTCTTGCCCTTGCCACTAATCCTCGAGGATTAGTGGCAAGGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-748s21c1
Sequence:CCGGCAACTATGATAAGGATCTTTCCTCGAGGAAAGATCCTTATCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-232s21c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-822s21c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-1744s21c1
Sequence:CCGGCACTCCTGTCCCAACGTTAATCTCGAGATTAACGTTGGGACAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-145s21c1
Sequence:CCGGGACTGCAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-556s21c1
Sequence:CCGGCAGAATGCCTTCAAGGTATTTCTCGAGAAATACCTTGAAGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-242s1c1
Sequence:CCGGCCCACCAAAGTGTTTAATCTTCTCGAGAAGATTAAACACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-152s1c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-656s1c1
Sequence:CCGGCCAGACAACTATGATAAGGATCTCGAGATCCTTATCATAGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-742s1c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-1472s1c1
Sequence:CCGGCGTCCAAGAAATTACAGTGTTCTCGAGAACACTGTAATTTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008825
VALIDATED
PFKFB2 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-1704s21c1
Sequence:CCGGCTCTTGCCCTTGCCACTAATCCTCGAGGATTAGTGGCAAGGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-748s21c1
Sequence:CCGGCAACTATGATAAGGATCTTTCCTCGAGGAAAGATCCTTATCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-232s21c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-822s21c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-1744s21c1
Sequence:CCGGCACTCCTGTCCCAACGTTAATCTCGAGATTAACGTTGGGACAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-145s21c1
Sequence:CCGGGACTGCAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-556s21c1
Sequence:CCGGCAGAATGCCTTCAAGGTATTTCTCGAGAAATACCTTGAAGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-242s1c1
Sequence:CCGGCCCACCAAAGTGTTTAATCTTCTCGAGAAGATTAAACACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-152s1c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-656s1c1
Sequence:CCGGCCAGACAACTATGATAAGGATCTCGAGATCCTTATCATAGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-742s1c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-1472s1c1
Sequence:CCGGCGTCCAAGAAATTACAGTGTTCTCGAGAACACTGTAATTTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008825
VALIDATED
PFKFB2 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-1704s21c1
Sequence:CCGGCTCTTGCCCTTGCCACTAATCCTCGAGGATTAGTGGCAAGGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.4-748s21c1
Sequence:CCGGCAACTATGATAAGGATCTTTCCTCGAGGAAAGATCCTTATCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-232s21c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-822s21c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-1744s21c1
Sequence:CCGGCACTCCTGTCCCAACGTTAATCTCGAGATTAACGTTGGGACAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008825.3-145s21c1
Sequence:CCGGGACTGCAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008825.3-556s21c1
Sequence:CCGGCAGAATGCCTTCAAGGTATTTCTCGAGAAATACCTTGAAGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-242s1c1
Sequence:CCGGCCCACCAAAGTGTTTAATCTTCTCGAGAAGATTAAACACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-152s1c1
Sequence:CCGGCCAACACTCATTGTTATGATTCTCGAGAATCATAACAATGAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008825.2-656s1c1
Sequence:CCGGCCAGACAACTATGATAAGGATCTCGAGATCCTTATCATAGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-742s1c1
Sequence:CCGGCCAGAGTAAGATTGTCTACTACTCGAGTAGTAGACAATCTTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008825.2-1472s1c1
Sequence:CCGGCGTCCAAGAAATTACAGTGTTCTCGAGAACACTGTAATTTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006212
VALIDATED
PFKFB2 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-1169s21c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5814s1c1
Sequence:CCGGGAATTGTGTCCAGGGATTTAACTCGAGTTAAATCCCTGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006212.2-730s1c1
Sequence:CCGGCAACTATGACAAGGATCTTTCCTCGAGGAAAGATCCTTGTCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-811s21c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-590s21c1
Sequence:CCGGCCTGATGTCATTGCTGCCAATCTCGAGATTGGCAGCAATGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-220s21c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-347s1c1
Sequence:CCGGGAAGCAGTCAAGTCCTATAAGCTCGAGCTTATAGGACTTGACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-1169s1c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5669s1c1
Sequence:CCGGCCATGTTGTGTTCATTGTTAACTCGAGTTAACAATGAACACAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-197s1c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-1504s1c1
Sequence:CCGGCGAATACAATAAGGCGTCCAACTCGAGTTGGACGCCTTATTGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-350s1c1
Sequence:CCGGCGACTTCTTTCGGCATGACAACTCGAGTTGTCATGCCGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-788s1c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006212
VALIDATED
PFKFB2 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-1169s21c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5814s1c1
Sequence:CCGGGAATTGTGTCCAGGGATTTAACTCGAGTTAAATCCCTGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006212.2-730s1c1
Sequence:CCGGCAACTATGACAAGGATCTTTCCTCGAGGAAAGATCCTTGTCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-811s21c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-590s21c1
Sequence:CCGGCCTGATGTCATTGCTGCCAATCTCGAGATTGGCAGCAATGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-220s21c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-347s1c1
Sequence:CCGGGAAGCAGTCAAGTCCTATAAGCTCGAGCTTATAGGACTTGACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-1169s1c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5669s1c1
Sequence:CCGGCCATGTTGTGTTCATTGTTAACTCGAGTTAACAATGAACACAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-197s1c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-1504s1c1
Sequence:CCGGCGAATACAATAAGGCGTCCAACTCGAGTTGGACGCCTTATTGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-350s1c1
Sequence:CCGGCGACTTCTTTCGGCATGACAACTCGAGTTGTCATGCCGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-788s1c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006212
VALIDATED
PFKFB2 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-1169s21c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5814s1c1
Sequence:CCGGGAATTGTGTCCAGGGATTTAACTCGAGTTAAATCCCTGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006212.2-730s1c1
Sequence:CCGGCAACTATGACAAGGATCTTTCCTCGAGGAAAGATCCTTGTCATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-811s21c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-590s21c1
Sequence:CCGGCCTGATGTCATTGCTGCCAATCTCGAGATTGGCAGCAATGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006212.2-220s21c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-347s1c1
Sequence:CCGGGAAGCAGTCAAGTCCTATAAGCTCGAGCTTATAGGACTTGACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-1169s1c1
Sequence:CCGGGAGAAGTATCTGTATCGATATCTCGAGATATCGATACAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006212.2-5669s1c1
Sequence:CCGGCCATGTTGTGTTCATTGTTAACTCGAGTTAACAATGAACACAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-197s1c1
Sequence:CCGGCCCGACTCTGATCGTTATGATCTCGAGATCATAACGATCAGAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-1504s1c1
Sequence:CCGGCGAATACAATAAGGCGTCCAACTCGAGTTGGACGCCTTATTGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006212.1-350s1c1
Sequence:CCGGCGACTTCTTTCGGCATGACAACTCGAGTTGTCATGCCGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006212.1-788s1c1
Sequence:CCGGCCAGAGCAAGATAGTCTACTACTCGAGTAGTAGACTATCTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks