EMAIL THIS PAGE TO A FRIEND

PGA5

pepsinogen 5, group I (pepsinogen A)

Synonyms: PGA3 PGA4
Gene ID:
Mouse(58803) pepsinogen 5, group I
Rat(60372) pepsinogen 5, group I
cow(414350) pepsinogen 5, group I (pepsinogen A)
Domestic Rabbit(100009429) pepsinogen 5, group I (pepsinogen A)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
P1490 Pepsinogen I human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014224 Rosetta Predictions human pricing
NM_021753 Rosetta Predictions rat pricing
NM_021453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236271 predicted 723
2 SASI_Hs01_00236272 predicted 411
3 SASI_Hs01_00236273 predicted 797
4 SASI_Hs01_00236274 predicted 286
5 SASI_Hs01_00236275 predicted 484
6 SASI_Hs01_00236276 predicted 713
7 SASI_Hs01_00236277 predicted 761
8 SASI_Hs01_00236278 predicted 669
9 SASI_Hs01_00236279 predicted 717
10 SASI_Hs01_00236280 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062884 predicted 353
2 SASI_Rn02_00262812 predicted 276
3 SASI_Rn01_00062885 predicted 1014
4 SASI_Rn01_00062886 predicted 528
5 SASI_Rn01_00062887 predicted 606
6 SASI_Rn01_00062888 predicted 1038
7 SASI_Rn01_00062889 predicted 944
8 SASI_Rn01_00062890 predicted 466
9 SASI_Rn01_00062891 predicted 1048
10 SASI_Rn01_00062892 predicted 873
11 SASI_Rn01_00062893 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183420 predicted 962
2 SASI_Mm01_00183421 predicted 362
3 SASI_Mm01_00183422 predicted 1100
4 SASI_Mm01_00183424 predicted 771
5 SASI_Mm01_00183425 predicted 673
6 SASI_Mm01_00183426 predicted 612
7 SASI_Mm01_00183427 predicted 974
8 SASI_Mm01_00183428 predicted 609
9 SASI_Mm01_00183429 predicted 1114
10 SASI_Mm02_00326104 predicted 905
11 SASI_Mm01_00183423 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014224
PGA5 MISSION shRNA Bacterial Glycerol Stock
pepsinogen 5, group I (pepsinogen A)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-617s21c1
Sequence:CCGGCACCCGTCTTTGACAACATCTCTCGAGAGATGTTGTCAAAGACGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-231s21c1
Sequence:CCGGCCTGGAGAACTACCTGGATATCTCGAGATATCCAGGTAGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-1149s21c1
Sequence:CCGGCGTCTTCGACAGGGCAAACAACTCGAGTTGTTTGCCCTGTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014224.1-1235s1c1
Sequence:CCGGCCTCCGTCCTATGCCCACTTTCTCGAGAAAGTGGGCATAGGACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-1091s1c1
Sequence:CCGGCCACCGAATCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-63s1c1
Sequence:CCGGGCTCTCTGAGTGCATCATGTACTCGAGTACATGATGCACTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-984s1c1
Sequence:CCGGCGACATCGTCTTCACCATCAACTCGAGTTGATGGTGAAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-545s1c1
Sequence:CCGGCCTTCCTGTATTATGCTCCCTCTCGAGAGGGAGCATAATACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014224
PGA5 MISSION shRNA shRNA Plasmid DNA
pepsinogen 5, group I (pepsinogen A)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-617s21c1
Sequence:CCGGCACCCGTCTTTGACAACATCTCTCGAGAGATGTTGTCAAAGACGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-231s21c1
Sequence:CCGGCCTGGAGAACTACCTGGATATCTCGAGATATCCAGGTAGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-1149s21c1
Sequence:CCGGCGTCTTCGACAGGGCAAACAACTCGAGTTGTTTGCCCTGTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014224.1-1235s1c1
Sequence:CCGGCCTCCGTCCTATGCCCACTTTCTCGAGAAAGTGGGCATAGGACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-1091s1c1
Sequence:CCGGCCACCGAATCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-63s1c1
Sequence:CCGGGCTCTCTGAGTGCATCATGTACTCGAGTACATGATGCACTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-984s1c1
Sequence:CCGGCGACATCGTCTTCACCATCAACTCGAGTTGATGGTGAAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-545s1c1
Sequence:CCGGCCTTCCTGTATTATGCTCCCTCTCGAGAGGGAGCATAATACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014224
PGA5 MISSION shRNA Lentiviral Transduction Particles
pepsinogen 5, group I (pepsinogen A)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-617s21c1
Sequence:CCGGCACCCGTCTTTGACAACATCTCTCGAGAGATGTTGTCAAAGACGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-231s21c1
Sequence:CCGGCCTGGAGAACTACCTGGATATCTCGAGATATCCAGGTAGTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014224.1-1149s21c1
Sequence:CCGGCGTCTTCGACAGGGCAAACAACTCGAGTTGTTTGCCCTGTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014224.1-1235s1c1
Sequence:CCGGCCTCCGTCCTATGCCCACTTTCTCGAGAAAGTGGGCATAGGACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-1091s1c1
Sequence:CCGGCCACCGAATCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-63s1c1
Sequence:CCGGGCTCTCTGAGTGCATCATGTACTCGAGTACATGATGCACTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-984s1c1
Sequence:CCGGCGACATCGTCTTCACCATCAACTCGAGTTGATGGTGAAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014224.1-545s1c1
Sequence:CCGGCCTTCCTGTATTATGCTCCCTCTCGAGAGGGAGCATAATACAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021453
PGA5 MISSION shRNA Bacterial Glycerol Stock
pepsinogen 5, group I (pepsinogen A)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1216s1c1
Sequence:CCGGCCGTGTTTGATCGGGCAAATACTCGAGTATTTGCCCGATCAAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-974s1c1
Sequence:CCGGCCAGAATCTAATTGGTGCCAACTCGAGTTGGCACCAATTAGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1107s1c1
Sequence:CCGGCGAAAGGATCGGTCACACAATCTCGAGATTGTGTGACCGATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-278s1c1
Sequence:CCGGAGCCGTAACTTATGAGCCTATCTCGAGATAGGCTCATAAGTTACGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-486s1c1
Sequence:CCGGCGACCTGTGAATGTTGCCTATCTCGAGATAGGCAACATTCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021453
PGA5 MISSION shRNA shRNA Plasmid DNA
pepsinogen 5, group I (pepsinogen A)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1216s1c1
Sequence:CCGGCCGTGTTTGATCGGGCAAATACTCGAGTATTTGCCCGATCAAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-974s1c1
Sequence:CCGGCCAGAATCTAATTGGTGCCAACTCGAGTTGGCACCAATTAGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1107s1c1
Sequence:CCGGCGAAAGGATCGGTCACACAATCTCGAGATTGTGTGACCGATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-278s1c1
Sequence:CCGGAGCCGTAACTTATGAGCCTATCTCGAGATAGGCTCATAAGTTACGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-486s1c1
Sequence:CCGGCGACCTGTGAATGTTGCCTATCTCGAGATAGGCAACATTCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021453
PGA5 MISSION shRNA Lentiviral Transduction Particles
pepsinogen 5, group I (pepsinogen A)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1216s1c1
Sequence:CCGGCCGTGTTTGATCGGGCAAATACTCGAGTATTTGCCCGATCAAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-974s1c1
Sequence:CCGGCCAGAATCTAATTGGTGCCAACTCGAGTTGGCACCAATTAGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-1107s1c1
Sequence:CCGGCGAAAGGATCGGTCACACAATCTCGAGATTGTGTGACCGATCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-278s1c1
Sequence:CCGGAGCCGTAACTTATGAGCCTATCTCGAGATAGGCTCATAAGTTACGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021453.2-486s1c1
Sequence:CCGGCGACCTGTGAATGTTGCCTATCTCGAGATAGGCAACATTCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks