EMAIL THIS PAGE TO A FRIEND

PGBD1

piggyBac transposable element derived 1

Synonyms: HUCEP-4 SCAND4 dJ874C20.4
UniProtKB ID: Q96JS3, Q53F43, Q6NTF5, Q8WWS4
Gene ID:
Human(84547) Summary: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Mouse(319207) piggyBac transposable element derived 1
naked mole-rat(101716946) piggyBac transposable element derived 1
cow(539564) piggyBac transposable element derived 1
sheep(101104865) piggyBac transposable element derived 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032507 Rosetta Predictions human pricing
NM_001012311 Rosetta Predictions mouse pricing
XR_032178 Rosetta Predictions mouse pricing
XR_032424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165308 predicted 2571
2 SASI_Hs02_00359993 predicted 490
3 SASI_Hs01_00165309 predicted 2677
4 SASI_Hs01_00165310 predicted 757
5 SASI_Hs01_00165311 predicted 2810
6 SASI_Hs02_00359994 predicted 2529
7 SASI_Hs01_00165312 predicted 1823
8 SASI_Hs01_00165314 predicted 2595
9 SASI_Hs01_00165316 predicted 2776
10 SASI_Hs02_00359995 predicted 872
11 SASI_Hs01_00165313 predicted 1781
12 SASI_Hs01_00165315 predicted 2821
13 SASI_Hs01_00165317 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053890 predicted 420
2 SASI_Mm01_00053891 predicted 1196
3 SASI_Mm01_00053892 predicted 406
4 SASI_Mm01_00053893 predicted 705
5 SASI_Mm01_00053894 predicted 1358
6 SASI_Mm01_00053895 predicted 1173
7 SASI_Mm01_00053896 predicted 1011
8 SASI_Mm01_00053897 predicted 1368
9 SASI_Mm01_00053898 predicted 1362
10 SASI_Mm01_00053899 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00463488 predicted 1027
2 SASI_Mm02_00463489 predicted 1016
3 SASI_Mm02_00463490 predicted 1423
4 SASI_Mm02_00463491 predicted 2406
5 SASI_Mm02_00463492 predicted 2079
6 SASI_Mm02_00463493 predicted 968
7 SASI_Mm02_00463494 predicted 1245
8 SASI_Mm02_00463495 predicted 954
9 SASI_Mm02_00463496 predicted 2089
10 SASI_Mm02_00463497 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00465059 predicted 1025
2 SASI_Mm02_00465060 predicted 1016
3 SASI_Mm02_00465061 predicted 1424
4 SASI_Mm02_00465062 predicted 2410
5 SASI_Mm02_00465063 predicted 2084
6 SASI_Mm02_00465064 predicted 969
7 SASI_Mm02_00465065 predicted 1241
8 SASI_Mm02_00465066 predicted 947
9 SASI_Mm02_00465067 predicted 2095
10 SASI_Mm02_00465068 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012311
PGBD1 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012311.1-710s1c1
Sequence:CCGGGCGTCCTTGCAGTACATTACTCTCGAGAGTAATGTACTGCAAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012311.2-1835s21c1
Sequence:CCGGACTTATGAATGTGGAACTTATCTCGAGATAAGTTCCACATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-553s21c1
Sequence:CCGGGGTGATGAAGCGGCGACATTACTCGAGTAATGTCGCCGCTTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-860s21c1
Sequence:CCGGTTGCGTCCTTGCAGTACATTACTCGAGTAATGTACTGCAAGGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1549s21c1
Sequence:CCGGCCTCTTCAAATTGGCTATAAACTCGAGTTTATAGCCAATTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1123s21c1
Sequence:CCGGGTAGAGCTCTTTGAATTATTTCTCGAGAAATAATTCAAAGAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012311
PGBD1 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012311.1-710s1c1
Sequence:CCGGGCGTCCTTGCAGTACATTACTCTCGAGAGTAATGTACTGCAAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012311.2-1835s21c1
Sequence:CCGGACTTATGAATGTGGAACTTATCTCGAGATAAGTTCCACATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-553s21c1
Sequence:CCGGGGTGATGAAGCGGCGACATTACTCGAGTAATGTCGCCGCTTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-860s21c1
Sequence:CCGGTTGCGTCCTTGCAGTACATTACTCGAGTAATGTACTGCAAGGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1549s21c1
Sequence:CCGGCCTCTTCAAATTGGCTATAAACTCGAGTTTATAGCCAATTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1123s21c1
Sequence:CCGGGTAGAGCTCTTTGAATTATTTCTCGAGAAATAATTCAAAGAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012311
PGBD1 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012311.1-710s1c1
Sequence:CCGGGCGTCCTTGCAGTACATTACTCTCGAGAGTAATGTACTGCAAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012311.2-1835s21c1
Sequence:CCGGACTTATGAATGTGGAACTTATCTCGAGATAAGTTCCACATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-553s21c1
Sequence:CCGGGGTGATGAAGCGGCGACATTACTCGAGTAATGTCGCCGCTTCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-860s21c1
Sequence:CCGGTTGCGTCCTTGCAGTACATTACTCGAGTAATGTACTGCAAGGACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1549s21c1
Sequence:CCGGCCTCTTCAAATTGGCTATAAACTCGAGTTTATAGCCAATTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012311.2-1123s21c1
Sequence:CCGGGTAGAGCTCTTTGAATTATTTCTCGAGAAATAATTCAAAGAGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032507
PGBD1 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1348s1c1
Sequence:CCGGGCACATCTCATCCCTGGAATACTCGAGTATTCCAGGGATGAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1984s1c1
Sequence:CCGGCCTGGAAGAATACTATTGCTTCTCGAGAAGCAATAGTATTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-2474s1c1
Sequence:CCGGGTGGGCATAGAACCAGTCAATCTCGAGATTGACTGGTTCTATGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2509s21c1
Sequence:CCGGTGATGCTGATAACGAAGAAATCTCGAGATTTCTTCGTTATCAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2789s21c1
Sequence:CCGGCTGTCAGATTAGGGTACATAACTCGAGTTATGTACCCTAATCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032507.2-2814s21c1
Sequence:CCGGGACATAGTGCAGACATTAATACTCGAGTATTAATGTCTGCACTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2633s21c1
Sequence:CCGGAGCAAGAAATGGTACTCAATTCTCGAGAATTGAGTACCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2057s21c1
Sequence:CCGGCCTATTAGAATTGGCTATAAACTCGAGTTTATAGCCAATTCTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032507
PGBD1 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1348s1c1
Sequence:CCGGGCACATCTCATCCCTGGAATACTCGAGTATTCCAGGGATGAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1984s1c1
Sequence:CCGGCCTGGAAGAATACTATTGCTTCTCGAGAAGCAATAGTATTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-2474s1c1
Sequence:CCGGGTGGGCATAGAACCAGTCAATCTCGAGATTGACTGGTTCTATGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2509s21c1
Sequence:CCGGTGATGCTGATAACGAAGAAATCTCGAGATTTCTTCGTTATCAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2789s21c1
Sequence:CCGGCTGTCAGATTAGGGTACATAACTCGAGTTATGTACCCTAATCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032507.2-2814s21c1
Sequence:CCGGGACATAGTGCAGACATTAATACTCGAGTATTAATGTCTGCACTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2633s21c1
Sequence:CCGGAGCAAGAAATGGTACTCAATTCTCGAGAATTGAGTACCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2057s21c1
Sequence:CCGGCCTATTAGAATTGGCTATAAACTCGAGTTTATAGCCAATTCTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032507
PGBD1 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1348s1c1
Sequence:CCGGGCACATCTCATCCCTGGAATACTCGAGTATTCCAGGGATGAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-1984s1c1
Sequence:CCGGCCTGGAAGAATACTATTGCTTCTCGAGAAGCAATAGTATTCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032507.2-2474s1c1
Sequence:CCGGGTGGGCATAGAACCAGTCAATCTCGAGATTGACTGGTTCTATGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2509s21c1
Sequence:CCGGTGATGCTGATAACGAAGAAATCTCGAGATTTCTTCGTTATCAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2789s21c1
Sequence:CCGGCTGTCAGATTAGGGTACATAACTCGAGTTATGTACCCTAATCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032507.2-2814s21c1
Sequence:CCGGGACATAGTGCAGACATTAATACTCGAGTATTAATGTCTGCACTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2633s21c1
Sequence:CCGGAGCAAGAAATGGTACTCAATTCTCGAGAATTGAGTACCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032507.2-2057s21c1
Sequence:CCGGCCTATTAGAATTGGCTATAAACTCGAGTTTATAGCCAATTCTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks