EMAIL THIS PAGE TO A FRIEND

PGBD5

piggyBac transposable element derived 5

UniProtKB ID: Q8N414, A0PJF3, B9EK58, Q5SR37, Q6PJN2
Gene ID:
Human(79605) Summary: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. [provided by RefSeq, May 2010]
Mouse(209966) piggyBac transposable element derived 5
Rat(292098) piggyBac transposable element derived 5
Zebrafish(570182) piggyBac transposable element derived 5
domestic cat(101094209) piggyBac transposable element derived 5
chicken(421541) piggyBac transposable element derived 5
domestic guinea pig(100724394) piggyBac transposable element derived 5
naked mole-rat(101717897) piggyBac transposable element derived 5
cow(101907907) piggyBac transposable element derived 5
cow(616498) piggyBac transposable element derived 5
sheep(101102869) piggyBac transposable element derived 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301178 Anti-PGBD5 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_171824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_171824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_171824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046681 MISSION® esiRNA esiRNA human PGBD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024554 Rosetta Predictions human pricing
NM_001106198 Rosetta Predictions rat pricing
NM_171824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161929 predicted 1465
2 SASI_Hs01_00161930 predicted 1912
3 SASI_Hs01_00161931 predicted 1157
4 SASI_Hs01_00161932 predicted 1143
5 SASI_Hs01_00161933 predicted 866
6 SASI_Hs02_00356859 predicted 1503
7 SASI_Hs01_00161935 predicted 1159
8 SASI_Hs01_00161936 predicted 1867
9 SASI_Hs01_00161937 predicted 945
10 SASI_Hs01_00161938 predicted 395
11 SASI_Hs01_00161934 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216598 predicted 588
2 SASI_Rn02_00216599 predicted 1456
3 SASI_Rn02_00216600 predicted 1365
4 SASI_Rn02_00216601 predicted 1129
5 SASI_Rn02_00216602 predicted 954
6 SASI_Rn02_00216603 predicted 1149
7 SASI_Rn02_00216604 predicted 1654
8 SASI_Rn02_00216605 predicted 1001
9 SASI_Rn02_00216606 predicted 839
10 SASI_Rn02_00216607 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153950 predicted 847
2 SASI_Mm01_00153951 predicted 843
3 SASI_Mm01_00153952 predicted 444
4 SASI_Mm01_00153953 predicted 1221
5 SASI_Mm01_00153954 predicted 366
6 SASI_Mm01_00153955 predicted 541
7 SASI_Mm01_00153956 predicted 994
8 SASI_Mm01_00153957 predicted 1166
9 SASI_Mm01_00153958 predicted 681
10 SASI_Mm01_00153959 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024554
VALIDATED
PGBD5 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-360s1c1
Sequence:CCGGGCCCTATAATCCATTCCTCGTCTCGAGACGAGGAATGGATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-1134s1c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024554.2-2982s1c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3247s1c1
Sequence:CCGGGCTGTGCCCTTTAATGGGATTCTCGAGAATCCCATTAAAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024554.2-981s1c1
Sequence:CCGGCCAGATTTATGTCCACCTGAACTCGAGTTCAGGTGGACATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-142s1c1
Sequence:CCGGCCATCTGTGTGGTCAGAACTTCTCGAGAAGTTCTGACCACACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-1150s1c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3090s1c1
Sequence:CCGGCCTCGTCCTCACTCAGTTATTCTCGAGAATAACTGAGTGAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-107s1c1
Sequence:CCGGCAAGCGATTCATTCACAGCCTCTCGAGAGGCTGTGAATGAATCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-606s1c1
Sequence:CCGGCTACATGATCTCCACCAGCATCTCGAGATGCTGGTGGAGATCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-867s21c1
Sequence:CCGGGATCGATGAGGATCCTGTATTCTCGAGAATACAGGATCCTCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-2982s21c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1091s21c1
Sequence:CCGGCAGGCAAGAACTACATCATTTCTCGAGAAATGATGTAGTTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1150s21c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1134s21c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024554
VALIDATED
PGBD5 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-360s1c1
Sequence:CCGGGCCCTATAATCCATTCCTCGTCTCGAGACGAGGAATGGATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-1134s1c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024554.2-2982s1c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3247s1c1
Sequence:CCGGGCTGTGCCCTTTAATGGGATTCTCGAGAATCCCATTAAAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024554.2-981s1c1
Sequence:CCGGCCAGATTTATGTCCACCTGAACTCGAGTTCAGGTGGACATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-142s1c1
Sequence:CCGGCCATCTGTGTGGTCAGAACTTCTCGAGAAGTTCTGACCACACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-1150s1c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3090s1c1
Sequence:CCGGCCTCGTCCTCACTCAGTTATTCTCGAGAATAACTGAGTGAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-107s1c1
Sequence:CCGGCAAGCGATTCATTCACAGCCTCTCGAGAGGCTGTGAATGAATCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-606s1c1
Sequence:CCGGCTACATGATCTCCACCAGCATCTCGAGATGCTGGTGGAGATCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-867s21c1
Sequence:CCGGGATCGATGAGGATCCTGTATTCTCGAGAATACAGGATCCTCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-2982s21c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1091s21c1
Sequence:CCGGCAGGCAAGAACTACATCATTTCTCGAGAAATGATGTAGTTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1150s21c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1134s21c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024554
VALIDATED
PGBD5 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-360s1c1
Sequence:CCGGGCCCTATAATCCATTCCTCGTCTCGAGACGAGGAATGGATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-1134s1c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024554.2-2982s1c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3247s1c1
Sequence:CCGGGCTGTGCCCTTTAATGGGATTCTCGAGAATCCCATTAAAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024554.2-981s1c1
Sequence:CCGGCCAGATTTATGTCCACCTGAACTCGAGTTCAGGTGGACATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-142s1c1
Sequence:CCGGCCATCTGTGTGGTCAGAACTTCTCGAGAAGTTCTGACCACACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024554.2-1150s1c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024554.2-3090s1c1
Sequence:CCGGCCTCGTCCTCACTCAGTTATTCTCGAGAATAACTGAGTGAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-107s1c1
Sequence:CCGGCAAGCGATTCATTCACAGCCTCTCGAGAGGCTGTGAATGAATCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024554.2-606s1c1
Sequence:CCGGCTACATGATCTCCACCAGCATCTCGAGATGCTGGTGGAGATCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-867s21c1
Sequence:CCGGGATCGATGAGGATCCTGTATTCTCGAGAATACAGGATCCTCATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-2982s21c1
Sequence:CCGGCAGACCAGAAACAAGGAATTTCTCGAGAAATTCCTTGTTTCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1091s21c1
Sequence:CCGGCAGGCAAGAACTACATCATTTCTCGAGAAATGATGTAGTTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1150s21c1
Sequence:CCGGGAGTTTGAGAAGCAAGGGATTCTCGAGAATCCCTTGCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024554.2-1134s21c1
Sequence:CCGGCCTGACGCTGTTTGAAGAGTTCTCGAGAACTCTTCAAACAGCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_171824
PGBD5 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-657s1c1
Sequence:CCGGCGGAAAGAACTATATCATCTTCTCGAGAAGATGATATAGTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-80s1c1
Sequence:CCGGCCAACATGTATGCCAGGAAGTCTCGAGACTTCCTGGCATACATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171824.1-1411s1c1
Sequence:CCGGGCTTTCCAGAGTGTGAAAGATCTCGAGATCTTTCACACTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-698s1c1
Sequence:CCGGGCCTCAATCTGTTCGAAGAATCTCGAGATTCTTCGAACAGATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-674s21c1
Sequence:CCGGGTGCTCTTCAACCGGGTTCATCTCGAGATGAACCCGGTTGAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-1172s21c1
Sequence:CCGGCGATAAGTACAGCAAGTATTTCTCGAGAAATACTTGCTGTACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_171824
PGBD5 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-657s1c1
Sequence:CCGGCGGAAAGAACTATATCATCTTCTCGAGAAGATGATATAGTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-80s1c1
Sequence:CCGGCCAACATGTATGCCAGGAAGTCTCGAGACTTCCTGGCATACATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171824.1-1411s1c1
Sequence:CCGGGCTTTCCAGAGTGTGAAAGATCTCGAGATCTTTCACACTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-698s1c1
Sequence:CCGGGCCTCAATCTGTTCGAAGAATCTCGAGATTCTTCGAACAGATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-674s21c1
Sequence:CCGGGTGCTCTTCAACCGGGTTCATCTCGAGATGAACCCGGTTGAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-1172s21c1
Sequence:CCGGCGATAAGTACAGCAAGTATTTCTCGAGAAATACTTGCTGTACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_171824
PGBD5 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-657s1c1
Sequence:CCGGCGGAAAGAACTATATCATCTTCTCGAGAAGATGATATAGTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-80s1c1
Sequence:CCGGCCAACATGTATGCCAGGAAGTCTCGAGACTTCCTGGCATACATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171824.1-1411s1c1
Sequence:CCGGGCTTTCCAGAGTGTGAAAGATCTCGAGATCTTTCACACTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171824.1-698s1c1
Sequence:CCGGGCCTCAATCTGTTCGAAGAATCTCGAGATTCTTCGAACAGATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-674s21c1
Sequence:CCGGGTGCTCTTCAACCGGGTTCATCTCGAGATGAACCCGGTTGAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171824.2-1172s21c1
Sequence:CCGGCGATAAGTACAGCAAGTATTTCTCGAGAAATACTTGCTGTACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks