EMAIL THIS PAGE TO A FRIEND

PGK2

phosphoglycerate kinase 2

Synonyms: PGKB PGKPS dJ417L20.2
UniProtKB ID: P07205, B2R6Y8, Q9H107
Gene ID:
Human(5232) Summary: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]
Mouse(18663) phosphoglycerate kinase 2
Rat(316265) phosphoglycerate kinase 2
domestic cat(101081547) phosphoglycerate kinase 2
Horse(100036552) phosphoglycerate kinase 2
dog(474933) phosphoglycerate kinase 2
cow(538592) phosphoglycerate kinase 2
sheep(101102678) phosphoglycerate kinase 2
domestic guinea pig(100728446) phosphoglycerate kinase 2
naked mole-rat(101698168) phosphoglycerate kinase 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108634 Anti-PGK2 affinity isolated antibody sheep, rabbit, horse, bovine, horse, human, mouse, canine, rat, zebrafish
western blot pricing
K1016 Anti-PGK2 (128-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV53820 Anti-PGK2 antibody produced in rabbit affinity isolated antibody human, guinea pig, pig, mouse, rat, horse, rabbit, sheep
western blot pricing
SAB2700972 Anti-PGK2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138733 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016761 MISSION® esiRNA esiRNA targeting human PGK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138733 Rosetta Predictions human pricing
NM_001012130 Rosetta Predictions rat pricing
XM_576525 Rosetta Predictions rat pricing
NM_031190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024717 predicted 675
2 SASI_Hs01_00024718 predicted 1360
3 SASI_Hs01_00024719 predicted 515
4 SASI_Hs01_00024720 predicted 498
5 SASI_Hs01_00024722 predicted 1077
6 SASI_Hs01_00024723 predicted 761
7 SASI_Hs01_00024724 predicted 671
8 SASI_Hs01_00024725 predicted 241
9 SASI_Hs01_00024726 predicted 1245
10 SASI_Hs02_00363840 predicted 1128
11 SASI_Hs01_00024721 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040073 predicted 914
2 SASI_Rn01_00040074 predicted 1237
3 SASI_Rn01_00040075 predicted 430
4 SASI_Rn01_00040076 predicted 759
5 SASI_Rn01_00040078 predicted 1280
6 SASI_Rn01_00040079 predicted 1117
7 SASI_Rn01_00040080 predicted 930
8 SASI_Rn01_00040081 predicted 372
9 SASI_Rn02_00200297 predicted 729
10 SASI_Rn02_00200298 predicted 462
11 SASI_Rn01_00040072 predicted 916
12 SASI_Rn01_00040077 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192927 predicted 1294
2 SASI_Rn01_00192928 predicted 1289
3 SASI_Rn01_00192929 predicted 1286
4 SASI_Rn01_00192930 predicted 1277
5 SASI_Rn01_00192931 predicted 1290
6 SASI_Rn01_00192932 predicted 1295
7 SASI_Rn01_00192933 predicted 1294
8 SASI_Rn01_00192934 predicted 1201
9 SASI_Rn01_00192935 predicted 1307
10 SASI_Rn01_00192936 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125127 predicted 534
2 SASI_Mm01_00125128 predicted 904
3 SASI_Mm01_00125129 predicted 395
4 SASI_Mm01_00125130 predicted 1090
5 SASI_Mm01_00125131 predicted 732
6 SASI_Mm01_00125132 predicted 410
7 SASI_Mm01_00125133 predicted 347
8 SASI_Mm01_00125135 predicted 918
9 SASI_Mm01_00125136 predicted 1210
10 SASI_Mm02_00337035 predicted 703
11 SASI_Mm01_00125134 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031190
PGK2 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1059s1c1
Sequence:CCGGGCCTTTGCTAAAGGAACCAAACTCGAGTTTGGTTCCTTTAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-350s1c1
Sequence:CCGGCCCAGATAATGGGTCTATCATCTCGAGATGATAGACCCATTATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1126s1c1
Sequence:CCGGCCATTATAGGAGGAGGAGATACTCGAGTATCTCCTCCTCCTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1005s1c1
Sequence:CCGGGCCCAAGCAAAGCTGATAGTTCTCGAGAACTATCAGCTTTGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-453s1c1
Sequence:CCGGGCTAAAGTAGAAGCCTTCCAACTCGAGTTGGAAGGCTTCTACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-1168s21c1
Sequence:CCGGATGGCTGTGTCACCATTATAGCTCGAGCTATAATGGTGACACAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-337s21c1
Sequence:CCGGTGCTGAACAAGGACGTCATATCTCGAGATATGACGTCCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031190.2-1385s21c1
Sequence:CCGGCTAACCTATATCTCAACATTTCTCGAGAAATGTTGAGATATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-594s21c1
Sequence:CCGGAGTTCTACGGTCGGAGTAAATCTCGAGATTTACTCCGACCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031190
PGK2 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1059s1c1
Sequence:CCGGGCCTTTGCTAAAGGAACCAAACTCGAGTTTGGTTCCTTTAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-350s1c1
Sequence:CCGGCCCAGATAATGGGTCTATCATCTCGAGATGATAGACCCATTATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1126s1c1
Sequence:CCGGCCATTATAGGAGGAGGAGATACTCGAGTATCTCCTCCTCCTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1005s1c1
Sequence:CCGGGCCCAAGCAAAGCTGATAGTTCTCGAGAACTATCAGCTTTGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-453s1c1
Sequence:CCGGGCTAAAGTAGAAGCCTTCCAACTCGAGTTGGAAGGCTTCTACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-1168s21c1
Sequence:CCGGATGGCTGTGTCACCATTATAGCTCGAGCTATAATGGTGACACAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-337s21c1
Sequence:CCGGTGCTGAACAAGGACGTCATATCTCGAGATATGACGTCCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031190.2-1385s21c1
Sequence:CCGGCTAACCTATATCTCAACATTTCTCGAGAAATGTTGAGATATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-594s21c1
Sequence:CCGGAGTTCTACGGTCGGAGTAAATCTCGAGATTTACTCCGACCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031190
PGK2 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1059s1c1
Sequence:CCGGGCCTTTGCTAAAGGAACCAAACTCGAGTTTGGTTCCTTTAGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-350s1c1
Sequence:CCGGCCCAGATAATGGGTCTATCATCTCGAGATGATAGACCCATTATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1126s1c1
Sequence:CCGGCCATTATAGGAGGAGGAGATACTCGAGTATCTCCTCCTCCTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-1005s1c1
Sequence:CCGGGCCCAAGCAAAGCTGATAGTTCTCGAGAACTATCAGCTTTGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031190.1-453s1c1
Sequence:CCGGGCTAAAGTAGAAGCCTTCCAACTCGAGTTGGAAGGCTTCTACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-1168s21c1
Sequence:CCGGATGGCTGTGTCACCATTATAGCTCGAGCTATAATGGTGACACAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-337s21c1
Sequence:CCGGTGCTGAACAAGGACGTCATATCTCGAGATATGACGTCCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031190.2-1385s21c1
Sequence:CCGGCTAACCTATATCTCAACATTTCTCGAGAAATGTTGAGATATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031190.2-594s21c1
Sequence:CCGGAGTTCTACGGTCGGAGTAAATCTCGAGATTTACTCCGACCGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138733
PGK2 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-513s1c1
Sequence:CCGGCCCTCTGGAAAGAAGATTAAACTCGAGTTTAATCTTCTTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-697s1c1
Sequence:CCGGACTTTGCTAAAGCCTTGGAAACTCGAGTTTCCAAGGCTTTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-279s1c1
Sequence:CCGGGCAGTAGTTCTTATGAGTCATCTCGAGATGACTCATAAGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-935s1c1
Sequence:CCGGGAATGGTGTAAGGATTACTTTCTCGAGAAAGTAATCCTTACACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1101s1c1
Sequence:CCGGGCAAGGCTAATTGTTTGGAATCTCGAGATTCCAAACAATTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-655s1c1
Sequence:CCGGCCCATAAAGCATCCGGATTCTCTCGAGAGAATCCGGATGCTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-354s1c1
Sequence:CCGGGCTGTTGAGCTCAAATCCTTGCTCGAGCAAGGATTTGAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-663s1c1
Sequence:CCGGGCATCCGGATTCTTGATGAAGCTCGAGCTTCATCAAGAATCCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1015s1c1
Sequence:CCGGCTGTAGCATCTGGCATATCTCCTCGAGGAGATATGCCAGATGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-162s1c1
Sequence:CCGGCGAGTCATCATGAGAGTAGACCTCGAGGTCTACTCTCATGATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138733.2-1487s1c1
Sequence:CCGGGCAGCAGGCCATCAGGAACTCCTCGAGGAGTTCCTGATGGCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138733.2-1460s1c1
Sequence:CCGGCTAGATCAAGACCTATGTAATCTCGAGATTACATAGGTCTTGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1069s1c1
Sequence:CCGGGCAACAAGAATCATGCTCAAGCTCGAGCTTGAGCATGATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138733
PGK2 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-513s1c1
Sequence:CCGGCCCTCTGGAAAGAAGATTAAACTCGAGTTTAATCTTCTTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-697s1c1
Sequence:CCGGACTTTGCTAAAGCCTTGGAAACTCGAGTTTCCAAGGCTTTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-279s1c1
Sequence:CCGGGCAGTAGTTCTTATGAGTCATCTCGAGATGACTCATAAGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-935s1c1
Sequence:CCGGGAATGGTGTAAGGATTACTTTCTCGAGAAAGTAATCCTTACACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1101s1c1
Sequence:CCGGGCAAGGCTAATTGTTTGGAATCTCGAGATTCCAAACAATTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-655s1c1
Sequence:CCGGCCCATAAAGCATCCGGATTCTCTCGAGAGAATCCGGATGCTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-354s1c1
Sequence:CCGGGCTGTTGAGCTCAAATCCTTGCTCGAGCAAGGATTTGAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-663s1c1
Sequence:CCGGGCATCCGGATTCTTGATGAAGCTCGAGCTTCATCAAGAATCCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1015s1c1
Sequence:CCGGCTGTAGCATCTGGCATATCTCCTCGAGGAGATATGCCAGATGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-162s1c1
Sequence:CCGGCGAGTCATCATGAGAGTAGACCTCGAGGTCTACTCTCATGATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138733.2-1487s1c1
Sequence:CCGGGCAGCAGGCCATCAGGAACTCCTCGAGGAGTTCCTGATGGCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138733.2-1460s1c1
Sequence:CCGGCTAGATCAAGACCTATGTAATCTCGAGATTACATAGGTCTTGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1069s1c1
Sequence:CCGGGCAACAAGAATCATGCTCAAGCTCGAGCTTGAGCATGATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138733
PGK2 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-513s1c1
Sequence:CCGGCCCTCTGGAAAGAAGATTAAACTCGAGTTTAATCTTCTTTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-697s1c1
Sequence:CCGGACTTTGCTAAAGCCTTGGAAACTCGAGTTTCCAAGGCTTTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-279s1c1
Sequence:CCGGGCAGTAGTTCTTATGAGTCATCTCGAGATGACTCATAAGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-935s1c1
Sequence:CCGGGAATGGTGTAAGGATTACTTTCTCGAGAAAGTAATCCTTACACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1101s1c1
Sequence:CCGGGCAAGGCTAATTGTTTGGAATCTCGAGATTCCAAACAATTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-655s1c1
Sequence:CCGGCCCATAAAGCATCCGGATTCTCTCGAGAGAATCCGGATGCTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-354s1c1
Sequence:CCGGGCTGTTGAGCTCAAATCCTTGCTCGAGCAAGGATTTGAGCTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-663s1c1
Sequence:CCGGGCATCCGGATTCTTGATGAAGCTCGAGCTTCATCAAGAATCCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1015s1c1
Sequence:CCGGCTGTAGCATCTGGCATATCTCCTCGAGGAGATATGCCAGATGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138733.2-162s1c1
Sequence:CCGGCGAGTCATCATGAGAGTAGACCTCGAGGTCTACTCTCATGATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138733.2-1487s1c1
Sequence:CCGGGCAGCAGGCCATCAGGAACTCCTCGAGGAGTTCCTGATGGCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138733.2-1460s1c1
Sequence:CCGGCTAGATCAAGACCTATGTAATCTCGAGATTACATAGGTCTTGATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138733.2-1069s1c1
Sequence:CCGGGCAACAAGAATCATGCTCAAGCTCGAGCTTGAGCATGATTCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks