EMAIL THIS PAGE TO A FRIEND

PGRMC1

progesterone receptor membrane component 1

Synonyms: HPR6.6 MPR
UniProtKB ID: O00264, Q9UGJ9
Gene ID:
Human(10857) Summary: This gene encodes a putative membrane-associated progesterone steroid receptor. The protein is expressed predominantly in the liver and kidney. [provided by RefSeq, Mar 2010]
Mouse(53328) progesterone receptor membrane component 1
Rat(291948) progesterone receptor membrane component 1
Zebrafish(492520) progesterone receptor membrane component 1
chicken(772196) progesterone receptor membrane component 1
dog(481029) progesterone receptor membrane component 1
domestic cat(101082383) progesterone receptor membrane component 1
cow(317706) progesterone receptor membrane component 1
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006667 Rosetta Predictions human pricing
NM_021766 Rosetta Predictions rat pricing
XM_579448 Rosetta Predictions rat pricing
NM_016783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176381 predicted 794
2 SASI_Hs01_00176382 predicted 663
3 SASI_Hs01_00176383 predicted 664
4 SASI_Hs01_00176385 predicted 787
5 SASI_Hs02_00342058 predicted 476
6 SASI_Hs01_00176389 predicted 732
7 SASI_Hs02_00342059 predicted 835
8 SASI_Hs01_00176380 predicted 351
9 SASI_Hs02_00342060 predicted 840
10 SASI_Hs01_00176384 predicted 272
11 SASI_Hs01_00176386 predicted 367
12 SASI_Hs01_00176387 predicted 501
13 SASI_Hs01_00176388 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038299 predicted 318
2 SASI_Rn01_00038300 predicted 1038
3 SASI_Rn01_00038301 predicted 806
4 SASI_Rn01_00038302 predicted 919
5 SASI_Rn01_00038303 predicted 892
6 SASI_Rn02_00262828 predicted 363
7 SASI_Rn01_00038304 predicted 844
8 SASI_Rn01_00038305 predicted 816
9 SASI_Rn01_00038307 predicted 870
10 SASI_Rn01_00038308 predicted 874
11 SASI_Rn01_00038306 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160589 predicted 286
2 SASI_Rn01_00160590 predicted 487
3 SASI_Rn01_00160591 predicted 307
4 SASI_Rn01_00160592 predicted 549
5 SASI_Rn01_00160593 predicted 625
6 SASI_Rn01_00160594 predicted 677
7 SASI_Rn01_00160595 predicted 672
8 SASI_Rn01_00160596 predicted 557
9 SASI_Rn01_00160597 predicted 746
10 SASI_Rn01_00160598 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121781 predicted 769
2 SASI_Mm01_00121782 predicted 861
3 SASI_Mm01_00121783 predicted 799
4 SASI_Mm01_00121789 predicted 445
5 SASI_Mm01_00121784 predicted 329
6 SASI_Mm02_00323561 predicted 833
7 SASI_Mm01_00121785 predicted 776
8 SASI_Mm01_00121786 predicted 525
9 SASI_Mm01_00121787 predicted 853
10 SASI_Mm01_00121788 predicted 913
11 SASI_Mm01_00121790 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006667
VALIDATED
PGRMC1 MISSION shRNA Bacterial Glycerol Stock
progesterone receptor membrane component 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-957s21c1
Sequence:CCGGAGTTAGTACAGGATGAATTTACTCGAGTAAATTCATCCTGTACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-146s21c1
Sequence:CCGGCGCCGACCCAAGCGATCTGGACTCGAGTCCAGATCGCTTGGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006667.3-413s21c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-648s21c1
Sequence:CCGGACTGTGTACTCAGATGAGGAACTCGAGTTCCTCATCTGAGTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-523s21c1
Sequence:CCGGAGGATGAGTACGATGACCTTTCTCGAGAAAGGTCATCGTACTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006667.2-375s1c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006667
VALIDATED
PGRMC1 MISSION shRNA shRNA Plasmid DNA
progesterone receptor membrane component 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-957s21c1
Sequence:CCGGAGTTAGTACAGGATGAATTTACTCGAGTAAATTCATCCTGTACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-146s21c1
Sequence:CCGGCGCCGACCCAAGCGATCTGGACTCGAGTCCAGATCGCTTGGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006667.3-413s21c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-648s21c1
Sequence:CCGGACTGTGTACTCAGATGAGGAACTCGAGTTCCTCATCTGAGTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-523s21c1
Sequence:CCGGAGGATGAGTACGATGACCTTTCTCGAGAAAGGTCATCGTACTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006667.2-375s1c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006667
VALIDATED
PGRMC1 MISSION shRNA Lentiviral Transduction Particles
progesterone receptor membrane component 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-957s21c1
Sequence:CCGGAGTTAGTACAGGATGAATTTACTCGAGTAAATTCATCCTGTACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-146s21c1
Sequence:CCGGCGCCGACCCAAGCGATCTGGACTCGAGTCCAGATCGCTTGGGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006667.3-413s21c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-648s21c1
Sequence:CCGGACTGTGTACTCAGATGAGGAACTCGAGTTCCTCATCTGAGTACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006667.3-523s21c1
Sequence:CCGGAGGATGAGTACGATGACCTTTCTCGAGAAAGGTCATCGTACTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006667.2-375s1c1
Sequence:CCGGTGTGACCAAAGGCCGCAAATTCTCGAGAATTTGCGGCCTTTGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016783
VALIDATED
PGRMC1 MISSION shRNA Bacterial Glycerol Stock
progesterone receptor membrane component 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-1224s1c1
Sequence:CCGGCCTGTGTTCGTGGACTGATTTCTCGAGAAATCAGTCCACGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-118s1c1
Sequence:CCGGGCGGACTGCTGCACGAGATTTCTCGAGAAATCTCGTGCAGCAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-533s1c1
Sequence:CCGGCTCTCAGTTCACTTTCAAGTACTCGAGTACTTGAAAGTGAACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-459s1c1
Sequence:CCGGGAAGCACTGAAGGATGAGTATCTCGAGATACTCATCCTTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-591s1c1
Sequence:CCGGCCTACTGTGTACTCAGATGATCTCGAGATCATCTGAGTACACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016783
VALIDATED
PGRMC1 MISSION shRNA shRNA Plasmid DNA
progesterone receptor membrane component 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-1224s1c1
Sequence:CCGGCCTGTGTTCGTGGACTGATTTCTCGAGAAATCAGTCCACGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-118s1c1
Sequence:CCGGGCGGACTGCTGCACGAGATTTCTCGAGAAATCTCGTGCAGCAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-533s1c1
Sequence:CCGGCTCTCAGTTCACTTTCAAGTACTCGAGTACTTGAAAGTGAACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-459s1c1
Sequence:CCGGGAAGCACTGAAGGATGAGTATCTCGAGATACTCATCCTTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-591s1c1
Sequence:CCGGCCTACTGTGTACTCAGATGATCTCGAGATCATCTGAGTACACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016783
VALIDATED
PGRMC1 MISSION shRNA Lentiviral Transduction Particles
progesterone receptor membrane component 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-1224s1c1
Sequence:CCGGCCTGTGTTCGTGGACTGATTTCTCGAGAAATCAGTCCACGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-118s1c1
Sequence:CCGGGCGGACTGCTGCACGAGATTTCTCGAGAAATCTCGTGCAGCAGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-533s1c1
Sequence:CCGGCTCTCAGTTCACTTTCAAGTACTCGAGTACTTGAAAGTGAACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-459s1c1
Sequence:CCGGGAAGCACTGAAGGATGAGTATCTCGAGATACTCATCCTTCAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016783.2-591s1c1
Sequence:CCGGCCTACTGTGTACTCAGATGATCTCGAGATCATCTGAGTACACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks