EMAIL THIS PAGE TO A FRIEND

PHACTR1

phosphatase and actin regulator 1

Synonyms: RPEL RPEL1 dJ257A7.2
UniProtKB ID: Q9C0D0, A8K1V2, Q3MJ93, Q5JSJ2
Gene ID:
Mouse(218194) phosphatase and actin regulator 1
Rat(306844) phosphatase and actin regulator 1
chicken(395093) phosphatase and actin regulator 1
dog(478723) phosphatase and actin regulator 1
domestic cat(101092683) phosphatase and actin regulator 1
Horse(100051555) phosphatase and actin regulator 1
cow(537594) phosphatase and actin regulator 1
sheep(101115323) phosphatase and actin regulator 1
domestic guinea pig(100726748) phosphatase and actin regulator 1
naked mole-rat(101720984) phosphatase and actin regulator 1
Gene Class: Cytoskeleton
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030948 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049701 MISSION® esiRNA esiRNA human RPEL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030948 Rosetta Predictions human pricing
NM_214457 Rosetta Predictions rat pricing
NM_001005740 Rosetta Predictions mouse pricing
NM_001005748 Rosetta Predictions mouse pricing
NM_198419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014343 predicted 1345
2 SASI_Hs01_00014345 predicted 250
3 SASI_Hs01_00014346 predicted 1732
4 SASI_Hs01_00014347 predicted 1280
5 SASI_Hs01_00014348 predicted 238
6 SASI_Hs01_00014349 predicted 213
7 SASI_Hs01_00014351 predicted 241
8 SASI_Hs02_00358529 predicted 886
9 SASI_Hs02_00358530 predicted 1322
10 SASI_Hs02_00358531 predicted 1268
11 SASI_Hs01_00014344 predicted 710
12 SASI_Hs01_00014350 predicted 1556
13 SASI_Hs01_00014352 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035706 predicted 1327
2 SASI_Rn01_00035707 predicted 1143
3 SASI_Rn02_00270632 predicted 1627
4 SASI_Rn01_00035708 predicted 1733
5 SASI_Rn01_00035709 predicted 1228
6 SASI_Rn01_00035711 predicted 1268
7 SASI_Rn01_00035712 predicted 775
8 SASI_Rn01_00035713 predicted 887
9 SASI_Rn01_00035714 predicted 871
10 SASI_Rn02_00270633 predicted 1551
11 SASI_Rn01_00035705 predicted 1169
12 SASI_Rn01_00035710 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094617 predicted 1929
2 SASI_Mm01_00094618 predicted 1240
3 SASI_Mm01_00094619 predicted 1319
4 SASI_Mm01_00094620 predicted 1513
5 SASI_Mm01_00094621 predicted 1928
6 SASI_Mm01_00094622 predicted 1768
7 SASI_Mm01_00094623 predicted 723
8 SASI_Mm01_00094624 predicted 443
9 SASI_Mm01_00094626 predicted 1588
10 SASI_Mm02_00286644 predicted 1306
11 SASI_Mm01_00094625 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025262 predicted 473
2 SASI_Mm01_00025263 predicted 351
3 SASI_Mm02_00286645 predicted 234
4 SASI_Mm01_00025264 predicted 825
5 SASI_Mm01_00025265 predicted 307
6 SASI_Mm01_00025266 predicted 825
7 SASI_Mm01_00025267 predicted 455
8 SASI_Mm01_00025268 predicted 108
9 SASI_Mm01_00025269 predicted 761
10 SASI_Mm01_00025270 predicted 421
11 SASI_Mm01_00025271 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091384 predicted 2257
2 SASI_Mm01_00091385 predicted 1571
3 SASI_Mm01_00091386 predicted 1658
4 SASI_Mm01_00091387 predicted 1850
5 SASI_Mm01_00091388 predicted 2262
6 SASI_Mm01_00091389 predicted 2100
7 SASI_Mm01_00091390 predicted 1060
8 SASI_Mm01_00091391 predicted 769
9 SASI_Mm01_00091393 predicted 1924
10 SASI_Mm02_00350981 predicted 1630
11 SASI_Mm01_00091392 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166420
VALIDATED
PHACTR1 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1344s1c1
Sequence:CCGGCGAAGACTCTTCTTGCCTGTACTCGAGTACAGGCAAGAAGAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-232s1c1
Sequence:CCGGGCTCACAGACTCTTGGATGTTCTCGAGAACATCCAAGAGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-691s1c1
Sequence:CCGGGAACTCTCTATATCCAATGAACTCGAGTTCATTGGATATAGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-262s1c1
Sequence:CCGGCAAAGATTCTTCTACAGTCAACTCGAGTTGACTGTAGAAGAATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1609s1c1
Sequence:CCGGGAACTGGAACAGAGGAACATTCTCGAGAATGTTCCTCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166420
VALIDATED
PHACTR1 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1344s1c1
Sequence:CCGGCGAAGACTCTTCTTGCCTGTACTCGAGTACAGGCAAGAAGAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-232s1c1
Sequence:CCGGGCTCACAGACTCTTGGATGTTCTCGAGAACATCCAAGAGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-691s1c1
Sequence:CCGGGAACTCTCTATATCCAATGAACTCGAGTTCATTGGATATAGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-262s1c1
Sequence:CCGGCAAAGATTCTTCTACAGTCAACTCGAGTTGACTGTAGAAGAATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1609s1c1
Sequence:CCGGGAACTGGAACAGAGGAACATTCTCGAGAATGTTCCTCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166420
VALIDATED
PHACTR1 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1344s1c1
Sequence:CCGGCGAAGACTCTTCTTGCCTGTACTCGAGTACAGGCAAGAAGAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-232s1c1
Sequence:CCGGGCTCACAGACTCTTGGATGTTCTCGAGAACATCCAAGAGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-691s1c1
Sequence:CCGGGAACTCTCTATATCCAATGAACTCGAGTTCATTGGATATAGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166420.5-262s1c1
Sequence:CCGGCAAAGATTCTTCTACAGTCAACTCGAGTTGACTGTAGAAGAATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_166420.5-1609s1c1
Sequence:CCGGGAACTGGAACAGAGGAACATTCTCGAGAATGTTCCTCTGTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005740
VALIDATED
PHACTR1 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005740.1-4724s1c1
Sequence:CCGGGCCATAAATAAACTGGCTCTTCTCGAGAAGAGCCAGTTTATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1928s1c1
Sequence:CCGGCCACGAGTTAAGTAGACACTTCTCGAGAAGTGTCTACTTAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1881s1c1
Sequence:CCGGGCCATTCGGAAGGAACTCAATCTCGAGATTGAGTTCCTTCCGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1323s1c1
Sequence:CCGGCCAACTGTTGTGATTGAATGTCTCGAGACATTCAATCACAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1306s1c1
Sequence:CCGGCGGAAATAAGACAAGTGCCAACTCGAGTTGGCACTTGTCTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-213s21c1
Sequence:CCGGTCCAAGAGCGACACGCCATATCTCGAGATATGGCGTGTCGCTCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-496s21c1
Sequence:CCGGTGAAGGAGATCTACGATAAAGCTCGAGCTTTATCGTAGATCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005740
VALIDATED
PHACTR1 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005740.1-4724s1c1
Sequence:CCGGGCCATAAATAAACTGGCTCTTCTCGAGAAGAGCCAGTTTATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1928s1c1
Sequence:CCGGCCACGAGTTAAGTAGACACTTCTCGAGAAGTGTCTACTTAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1881s1c1
Sequence:CCGGGCCATTCGGAAGGAACTCAATCTCGAGATTGAGTTCCTTCCGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1323s1c1
Sequence:CCGGCCAACTGTTGTGATTGAATGTCTCGAGACATTCAATCACAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1306s1c1
Sequence:CCGGCGGAAATAAGACAAGTGCCAACTCGAGTTGGCACTTGTCTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-213s21c1
Sequence:CCGGTCCAAGAGCGACACGCCATATCTCGAGATATGGCGTGTCGCTCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-496s21c1
Sequence:CCGGTGAAGGAGATCTACGATAAAGCTCGAGCTTTATCGTAGATCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005740
VALIDATED
PHACTR1 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005740.1-4724s1c1
Sequence:CCGGGCCATAAATAAACTGGCTCTTCTCGAGAAGAGCCAGTTTATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1928s1c1
Sequence:CCGGCCACGAGTTAAGTAGACACTTCTCGAGAAGTGTCTACTTAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001005740.1-1881s1c1
Sequence:CCGGGCCATTCGGAAGGAACTCAATCTCGAGATTGAGTTCCTTCCGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1323s1c1
Sequence:CCGGCCAACTGTTGTGATTGAATGTCTCGAGACATTCAATCACAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005740.1-1306s1c1
Sequence:CCGGCGGAAATAAGACAAGTGCCAACTCGAGTTGGCACTTGTCTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-213s21c1
Sequence:CCGGTCCAAGAGCGACACGCCATATCTCGAGATATGGCGTGTCGCTCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005740.1-496s21c1
Sequence:CCGGTGAAGGAGATCTACGATAAAGCTCGAGCTTTATCGTAGATCTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030948
VALIDATED
PHACTR1 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030948.1-1255s21c1
Sequence:CCGGCCTATGGGCCTTCCAGAAATACTCGAGTATTTCTGGAAGGCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1947s21c1
Sequence:CCGGTTGAGTGCTATGCTGTCTTCACTCGAGTGAAGACAGCATAGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-634s21c1
Sequence:CCGGAGCAGAGAAGAGCTGATAAAGCTCGAGCTTTATCAGCTCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1398s21c1
Sequence:CCGGAGACGACGACAGCTCATTATACTCGAGTATAATGAGCTGTCGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1892s21c1
Sequence:CCGGATGAATTGAGTAGACACTTAACTCGAGTTAAGTGTCTACTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1295s21c1
Sequence:CCGGTGATTGAATGTGATGACAATACTCGAGTATTGTCATCACATTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1451s21c1
Sequence:CCGGAGGACTCCTTAGCCATCAAACCTCGAGGTTTGATGGCTAAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-659s21c1
Sequence:CCGGGAGTCCTGAAGGAAATCTATGCTCGAGCATAGATTTCCTTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1976s21c1
Sequence:CCGGATTTATAAGAACCATAAGTGCCTCGAGGCACTTATGGTTCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030948
VALIDATED
PHACTR1 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030948.1-1255s21c1
Sequence:CCGGCCTATGGGCCTTCCAGAAATACTCGAGTATTTCTGGAAGGCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1947s21c1
Sequence:CCGGTTGAGTGCTATGCTGTCTTCACTCGAGTGAAGACAGCATAGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-634s21c1
Sequence:CCGGAGCAGAGAAGAGCTGATAAAGCTCGAGCTTTATCAGCTCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1398s21c1
Sequence:CCGGAGACGACGACAGCTCATTATACTCGAGTATAATGAGCTGTCGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1892s21c1
Sequence:CCGGATGAATTGAGTAGACACTTAACTCGAGTTAAGTGTCTACTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1295s21c1
Sequence:CCGGTGATTGAATGTGATGACAATACTCGAGTATTGTCATCACATTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1451s21c1
Sequence:CCGGAGGACTCCTTAGCCATCAAACCTCGAGGTTTGATGGCTAAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-659s21c1
Sequence:CCGGGAGTCCTGAAGGAAATCTATGCTCGAGCATAGATTTCCTTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1976s21c1
Sequence:CCGGATTTATAAGAACCATAAGTGCCTCGAGGCACTTATGGTTCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030948
VALIDATED
PHACTR1 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030948.1-1255s21c1
Sequence:CCGGCCTATGGGCCTTCCAGAAATACTCGAGTATTTCTGGAAGGCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1947s21c1
Sequence:CCGGTTGAGTGCTATGCTGTCTTCACTCGAGTGAAGACAGCATAGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-634s21c1
Sequence:CCGGAGCAGAGAAGAGCTGATAAAGCTCGAGCTTTATCAGCTCTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1398s21c1
Sequence:CCGGAGACGACGACAGCTCATTATACTCGAGTATAATGAGCTGTCGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1892s21c1
Sequence:CCGGATGAATTGAGTAGACACTTAACTCGAGTTAAGTGTCTACTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1295s21c1
Sequence:CCGGTGATTGAATGTGATGACAATACTCGAGTATTGTCATCACATTCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-1451s21c1
Sequence:CCGGAGGACTCCTTAGCCATCAAACCTCGAGGTTTGATGGCTAAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030948.1-659s21c1
Sequence:CCGGGAGTCCTGAAGGAAATCTATGCTCGAGCATAGATTTCCTTCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030948.1-1976s21c1
Sequence:CCGGATTTATAAGAACCATAAGTGCCTCGAGGCACTTATGGTTCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks