EMAIL THIS PAGE TO A FRIEND

PHB

prohibitin

Synonyms: PHB1
UniProtKB ID: P35232, Q4VBQ0
Gene ID:
Human(5245) Summary: Prohibitin is an evolutionarily conserved gene that is ubiquitously expressed. It is thought to be a negative regulator of cell proliferation and may be a tumor suppressor. Mutations in PHB have been linked to sporadic breast cancer. Prohibitin is expressed as two transcripts with varying lengths of 3' untranslated region. The longer transcript is present at higher levels in proliferating tissues and cells, suggesting that this longer 3' untranslated region may function as a trans-acting regulatory RNA. [provided by RefSeq, Jul 2008]
Mouse(18673) prohibitin
Rat(25344) prohibitin
cow(530409) prohibitin
sheep(101111817) prohibitin
Thale Cress(818036) homeobox-leucine zipper protein ATHB-14
dog(480547) prohibitin
dog(484431) prohibitin
Zebrafish(321346) prohibitin
chicken(419980) prohibitin
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701677 Anti-phb antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2701814 Anti-phb antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2107895 Anti-PHB antibody produced in rabbit affinity isolated antibody mouse, rat, bovine, rabbit, human, horse, pig, canine, zebrafish, guinea pig
immunohistochemistry, western blot pricing
HPA003280 Anti-PHB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107620 Anti-PHB antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, mouse
ELISA, western blot pricing
SAB1305985 ANTI-PHB1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306486 ANTI-PROHIBITIN (PHB1)(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
WH0005245M1 Monoclonal Anti-PHB antibody produced in mouse clone 3F4-2B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404197 Monoclonal Anti-PHB antibody produced in mouse clone 4B12-2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300404 Monoclonal Anti-PHB antibody produced in mouse clone 5H7, ascites fluid mouse, human, rat, monkey
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0293 AQUA Peptide DLQNVNITL[R] Drosophila melanogaster, African clawed frog, chicken, dog, honey bee, human, mouse, rat, wheat pricing
AQ0292 AQUA Peptide IYTSIGEDYDE[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002634 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002634 Rosetta Predictions human pricing
NM_031851 Rosetta Predictions rat pricing
XM_001053030 Rosetta Predictions rat pricing
XM_001053031 Rosetta Predictions rat pricing
NM_008831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242234 predicted 1029
2 SASI_Hs01_00242235 predicted 1230
3 SASI_Hs01_00242237 predicted 513
4 SASI_Hs01_00242238 predicted 1055
5 SASI_Hs01_00242239 predicted 268
6 SASI_Hs01_00242241 predicted 1038
7 SASI_Hs01_00242242 predicted 195
8 SASI_Hs02_00334155 predicted 1129
9 SASI_Hs02_00334156 predicted 1128
10 SASI_Hs02_00334157 predicted 1024
11 SASI_Hs01_00242236 predicted 245
12 SASI_Hs01_00242240 predicted 557
13 SASI_Hs01_00242243 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051464 predicted 1177
2 SASI_Rn01_00051465 predicted 1170
3 SASI_Rn01_00051466 predicted 1187
4 SASI_Rn01_00051467 predicted 1176
5 SASI_Rn01_00051468 predicted 1251
6 SASI_Rn01_00051469 predicted 1186
7 SASI_Rn02_00265348 predicted 266
8 SASI_Rn02_00265349 predicted 376
9 SASI_Rn01_00051470 predicted 986
10 SASI_Rn01_00051471 predicted 955
11 SASI_Rn01_00051472 predicted 316
12 SASI_Rn01_00051473 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271091 predicted 1228
2 SASI_Rn02_00271092 predicted 1162
3 SASI_Rn02_00271093 predicted 1400
4 SASI_Rn02_00271094 predicted 1461
5 SASI_Rn02_00271095 predicted 1160
6 SASI_Rn02_00271096 predicted 1109
7 SASI_Rn02_00271097 predicted 1466
8 SASI_Rn02_00271098 predicted 1616
9 SASI_Rn02_00271099 predicted 1612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271100 predicted 1130
2 SASI_Rn02_00271101 predicted 1128
3 SASI_Rn02_00271102 predicted 1132
4 SASI_Rn02_00271103 predicted 1132
5 SASI_Rn02_00271104 predicted 1203
6 SASI_Rn02_00271105 predicted 1134
7 SASI_Rn02_00271106 predicted 221
8 SASI_Rn02_00271107 predicted 908
9 SASI_Rn02_00271108 predicted 326
10 SASI_Rn02_00271109 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093151 predicted 1208
2 SASI_Mm01_00093152 predicted 1050
3 SASI_Mm01_00093153 predicted 1009
4 SASI_Mm01_00093154 predicted 1260
5 SASI_Mm01_00093155 predicted 1055
6 SASI_Mm01_00093156 predicted 338
7 SASI_Mm01_00093157 predicted 1195
8 SASI_Mm01_00093158 predicted 1203
9 SASI_Mm01_00093159 predicted 1209
10 SASI_Mm01_00093160 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008831
VALIDATED
PHB MISSION shRNA Bacterial Glycerol Stock
prohibitin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-550s21c1
Sequence:CCGGGAGCGGCAACATTTGGGCTTACTCGAGTAAGCCCAAATGTTGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008831.3-1013s21c1
Sequence:CCGGATCACTTCAGATCTCTAATTACTCGAGTAATTAGAGATCTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-341s21c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-832s21c1
Sequence:CCGGTCTCCCGCTCTCGGAACATCACTCGAGTGATGTTCCGAGAGCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008831.2-1175s1c1
Sequence:CCGGGCCTCCATTCTGCCGTATATTCTCGAGAATATACGGCAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008831.2-366s1c1
Sequence:CCGGCCTCGTATCTACACCAGCATTCTCGAGAATGCTGGTGTAGATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-317s1c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-413s1c1
Sequence:CCGGGCCTTCTATCACCACAGAGATCTCGAGATCTCTGTGGTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-119s1c1
Sequence:CCGGCGTGGTGAACTCTGCTTTGTACTCGAGTACAAAGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008831
VALIDATED
PHB MISSION shRNA shRNA Plasmid DNA
prohibitin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-550s21c1
Sequence:CCGGGAGCGGCAACATTTGGGCTTACTCGAGTAAGCCCAAATGTTGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008831.3-1013s21c1
Sequence:CCGGATCACTTCAGATCTCTAATTACTCGAGTAATTAGAGATCTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-341s21c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-832s21c1
Sequence:CCGGTCTCCCGCTCTCGGAACATCACTCGAGTGATGTTCCGAGAGCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008831.2-1175s1c1
Sequence:CCGGGCCTCCATTCTGCCGTATATTCTCGAGAATATACGGCAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008831.2-366s1c1
Sequence:CCGGCCTCGTATCTACACCAGCATTCTCGAGAATGCTGGTGTAGATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-317s1c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-413s1c1
Sequence:CCGGGCCTTCTATCACCACAGAGATCTCGAGATCTCTGTGGTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-119s1c1
Sequence:CCGGCGTGGTGAACTCTGCTTTGTACTCGAGTACAAAGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008831
VALIDATED
PHB MISSION shRNA Lentiviral Transduction Particles
prohibitin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-550s21c1
Sequence:CCGGGAGCGGCAACATTTGGGCTTACTCGAGTAAGCCCAAATGTTGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008831.3-1013s21c1
Sequence:CCGGATCACTTCAGATCTCTAATTACTCGAGTAATTAGAGATCTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-341s21c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008831.3-832s21c1
Sequence:CCGGTCTCCCGCTCTCGGAACATCACTCGAGTGATGTTCCGAGAGCGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008831.2-1175s1c1
Sequence:CCGGGCCTCCATTCTGCCGTATATTCTCGAGAATATACGGCAGAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008831.2-366s1c1
Sequence:CCGGCCTCGTATCTACACCAGCATTCTCGAGAATGCTGGTGTAGATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-317s1c1
Sequence:CCGGCGTCAATATCACACTGCGAATCTCGAGATTCGCAGTGTGATATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-413s1c1
Sequence:CCGGGCCTTCTATCACCACAGAGATCTCGAGATCTCTGTGGTGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008831.2-119s1c1
Sequence:CCGGCGTGGTGAACTCTGCTTTGTACTCGAGTACAAAGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002634
VALIDATED
PHB MISSION shRNA Bacterial Glycerol Stock
prohibitin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-427s21c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-605s21c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002634.2-975s21c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-136s21c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-975s1c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-248s1c1
Sequence:CCGGCCGTGGGTACAGAAACCAATTCTCGAGAATTGGTTTCTGTACCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-427s1c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-605s1c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002634.2-136s1c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002634
VALIDATED
PHB MISSION shRNA shRNA Plasmid DNA
prohibitin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-427s21c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-605s21c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002634.2-975s21c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-136s21c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-975s1c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-248s1c1
Sequence:CCGGCCGTGGGTACAGAAACCAATTCTCGAGAATTGGTTTCTGTACCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-427s1c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-605s1c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002634.2-136s1c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002634
VALIDATED
PHB MISSION shRNA Lentiviral Transduction Particles
prohibitin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-427s21c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-605s21c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002634.2-975s21c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002634.2-136s21c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-975s1c1
Sequence:CCGGCCCAGAAATCACTGTGAAATTCTCGAGAATTTCACAGTGATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-248s1c1
Sequence:CCGGCCGTGGGTACAGAAACCAATTCTCGAGAATTGGTTTCTGTACCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-427s1c1
Sequence:CCGGGCTGCCGTCCATCACAACTGACTCGAGTCAGTTGTGATGGACGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002634.2-605s1c1
Sequence:CCGGGAGTTCACAGAAGCGGTGGAACTCGAGTTCCACCGCTTCTGTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002634.2-136s1c1
Sequence:CCGGCGTGGTGAACTCTGCCTTATACTCGAGTATAAGGCAGAGTTCACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks