EMAIL THIS PAGE TO A FRIEND

PHF5A

PHD finger protein 5A

Synonyms: INI Rds3 SAP14b SF3b14b bK223H9.2
UniProtKB ID: Q7RTV0, Q9UH06
Gene ID:
Human(84844) Summary: This gene encodes a subunit of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. The protein encoded by this gene contains a PHD-finger-like domain that is flanked by highly basic N- and C-termini. This protein belongs to the PHD-finger superfamily and may act as a chromatin-associated protein. This gene has several pseudogenes on different chromosomes. [provided by RefSeq, Jul 2008]
Mouse(68479) PHD finger protein 5A
Rat(192246) PHD finger protein 5A
cow(507180) PHD finger protein 5A
sheep(101110927) PHD finger protein 5A
naked mole-rat(101706112) PHD finger protein 5A
domestic guinea pig(100735929) PHD finger protein 5A
Zebrafish(286774) PHD finger protein 5A
chicken(417991) PHD finger protein 5A
domestic cat(101101147) PHD finger protein 5A
dog(474489) PHD finger protein 5A
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032758 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032758 Rosetta Predictions human pricing
NM_138888 Rosetta Predictions rat pricing
NM_026737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137936 predicted 530
2 SASI_Hs01_00137943 predicted 534
3 SASI_Hs02_00360305 predicted 574
4 SASI_Hs01_00137935 predicted 336
5 SASI_Hs01_00137937 predicted 335
6 SASI_Hs01_00137938 predicted 604
7 SASI_Hs01_00137939 predicted 297
8 SASI_Hs01_00137940 predicted 323
9 SASI_Hs01_00137941 predicted 300
10 SASI_Hs02_00360306 predicted 477
11 SASI_Hs01_00137934 predicted 363
12 SASI_Hs01_00137942 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105833 predicted 279
2 SASI_Rn01_00105834 predicted 543
3 SASI_Rn02_00268323 predicted 534
4 SASI_Rn01_00105835 predicted 238
5 SASI_Rn02_00268324 predicted 554
6 SASI_Rn01_00105836 predicted 545
7 SASI_Rn01_00105837 predicted 252
8 SASI_Rn02_00268325 predicted 528
9 SASI_Rn01_00105841 predicted 604
10 SASI_Rn02_00268326 predicted 542
11 SASI_Rn01_00105838 predicted 599
12 SASI_Rn01_00105839 predicted 502
13 SASI_Rn01_00105840 predicted 612
14 SASI_Rn01_00105842 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149811 predicted 262
2 SASI_Mm02_00330781 predicted 748
3 SASI_Mm01_00149812 predicted 316
4 SASI_Mm02_00330782 predicted 725
5 SASI_Mm01_00149814 predicted 592
6 SASI_Mm01_00149815 predicted 415
7 SASI_Mm02_00330783 predicted 628
8 SASI_Mm01_00149818 predicted 279
9 SASI_Mm01_00149819 predicted 462
10 SASI_Mm02_00330784 predicted 238
11 SASI_Mm01_00149813 predicted 552
12 SASI_Mm01_00149816 predicted 326
13 SASI_Mm01_00149817 predicted 606
14 SASI_Mm01_00149820 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026737
VALIDATED
PHF5A MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 5A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-595s1c1
Sequence:CCGGCAAGGCTCTGTTCTCCACATTCTCGAGAATGTGGAGAACAGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-122s1c1
Sequence:CCGGGCAAGTGTGTGATCTGTGATTCTCGAGAATCACAGATCACACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-92s1c1
Sequence:CCGGCTATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-168s1c1
Sequence:CCGGCCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-328s1c1
Sequence:CCGGGACCTGTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026737
VALIDATED
PHF5A MISSION shRNA shRNA Plasmid DNA
PHD finger protein 5A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-595s1c1
Sequence:CCGGCAAGGCTCTGTTCTCCACATTCTCGAGAATGTGGAGAACAGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-122s1c1
Sequence:CCGGGCAAGTGTGTGATCTGTGATTCTCGAGAATCACAGATCACACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-92s1c1
Sequence:CCGGCTATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-168s1c1
Sequence:CCGGCCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-328s1c1
Sequence:CCGGGACCTGTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026737
VALIDATED
PHF5A MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 5A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-595s1c1
Sequence:CCGGCAAGGCTCTGTTCTCCACATTCTCGAGAATGTGGAGAACAGAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-122s1c1
Sequence:CCGGGCAAGTGTGTGATCTGTGATTCTCGAGAATCACAGATCACACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-92s1c1
Sequence:CCGGCTATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026737.1-168s1c1
Sequence:CCGGCCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026737.1-328s1c1
Sequence:CCGGGACCTGTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032758
VALIDATED
PHF5A MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 5A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032758.3-443s1c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-180s1c1
Sequence:CCGGGCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032758.3-340s1c1
Sequence:CCGGGACCTCTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-139s1c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-104s1c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-245s21c1
Sequence:CCGGGGGTCTCTGATGCCTATTATTCTCGAGAATAATAGGCATCAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-443s21c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-139s21c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-367s21c1
Sequence:CCGGGGCTTCAAGAAGAGGTGATTGCTCGAGCAATCACCTCTTCTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-104s21c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032758
VALIDATED
PHF5A MISSION shRNA shRNA Plasmid DNA
PHD finger protein 5A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032758.3-443s1c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-180s1c1
Sequence:CCGGGCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032758.3-340s1c1
Sequence:CCGGGACCTCTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-139s1c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-104s1c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-245s21c1
Sequence:CCGGGGGTCTCTGATGCCTATTATTCTCGAGAATAATAGGCATCAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-443s21c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-139s21c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-367s21c1
Sequence:CCGGGGCTTCAAGAAGAGGTGATTGCTCGAGCAATCACCTCTTCTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-104s21c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032758
VALIDATED
PHF5A MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 5A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032758.3-443s1c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-180s1c1
Sequence:CCGGGCGCATATGTGATGAGTGTAACTCGAGTTACACTCATCACATATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032758.3-340s1c1
Sequence:CCGGGACCTCTTCTATGAACGCAAACTCGAGTTTGCGTTCATAGAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-139s1c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032758.3-104s1c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-245s21c1
Sequence:CCGGGGGTCTCTGATGCCTATTATTCTCGAGAATAATAGGCATCAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-443s21c1
Sequence:CCGGGCCTACTACTACCAGCAGAAACTCGAGTTTCTGCTGGTAGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-139s21c1
Sequence:CCGGTGTGTGATTTGTGACTCCTATCTCGAGATAGGAGTCACAAATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032758.3-367s21c1
Sequence:CCGGGGCTTCAAGAAGAGGTGATTGCTCGAGCAATCACCTCTTCTTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032758.3-104s21c1
Sequence:CCGGCCATCGGAAGACTGTGTGAAACTCGAGTTTCACACAGTCTTCCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks