EMAIL THIS PAGE TO A FRIEND

PHKA1

phosphorylase kinase, alpha 1 (muscle)

Synonyms: PHKA
UniProtKB ID: P46020, B7ZL05, B7ZL07, Q2M3D7
Gene ID:
Human(5255) Summary: Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010]
Mouse(18679) phosphorylase kinase alpha 1
Rat(64561) phosphorylase kinase, alpha 1
Zebrafish(572183) phosphorylase kinase, alpha 1 (muscle)
chicken(422181) phosphorylase kinase, alpha 1 (muscle)
domestic cat(101096789) phosphorylase kinase, alpha 1 (muscle)
Horse(100051524) phosphorylase kinase, alpha 1 (muscle)
dog(491956) phosphorylase kinase, alpha 1 (muscle)
cow(100336808) phosphorylase kinase, alpha 1 (muscle)
cow(525990) phosphorylase kinase, alpha 1 (muscle)
sheep(101110737) phosphorylase kinase, alpha 1 (muscle)
naked mole-rat(101699364) phosphorylase kinase, alpha 1 (muscle)
domestic guinea pig(100726293) phosphorylase kinase, alpha 1 (muscle)
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122670 Rosetta Predictions human pricing
NM_002637 Rosetta Predictions human pricing
NM_022626 Rosetta Predictions rat pricing
NM_008832 Rosetta Predictions mouse pricing
NM_173021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327166 predicted 2120
2 SASI_Hs02_00327167 predicted 3552
3 SASI_Hs02_00327168 predicted 1726
4 SASI_Hs02_00327169 predicted 3004
5 SASI_Hs02_00327170 predicted 968
6 SASI_Hs02_00327171 predicted 834
7 SASI_Hs02_00327172 predicted 1530
8 SASI_Hs02_00327173 predicted 1206
9 SASI_Hs02_00327174 predicted 2371
10 SASI_Hs02_00327175 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077888 predicted 2120
2 SASI_Hs01_00077889 predicted 3593
3 SASI_Hs02_00334161 predicted 1730
4 SASI_Hs01_00077890 predicted 2996
5 SASI_Hs01_00077891 predicted 970
6 SASI_Hs02_00334162 predicted 828
7 SASI_Hs02_00334163 predicted 1526
8 SASI_Hs01_00077894 predicted 1200
9 SASI_Hs02_00334164 predicted 2370
10 SASI_Hs01_00077895 predicted 774
11 SASI_Hs01_00077892 predicted 2441
12 SASI_Hs01_00077893 predicted 1862
13 SASI_Hs01_00077896 predicted 3104
14 SASI_Hs01_00077897 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080626 predicted 2753
2 SASI_Rn01_00080627 predicted 903
3 SASI_Rn02_00263411 predicted 2347
4 SASI_Rn01_00080629 predicted 2946
5 SASI_Rn02_00263412 predicted 2698
6 SASI_Rn01_00080631 predicted 2860
7 SASI_Rn01_00080632 predicted 2078
8 SASI_Rn01_00080633 predicted 2028
9 SASI_Rn01_00080634 predicted 3225
10 SASI_Rn01_00080635 predicted 3187
11 SASI_Rn01_00080628 predicted 1984
12 SASI_Rn01_00080630 predicted 3250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314769 predicted 618
2 SASI_Mm01_00061158 predicted 3269
3 SASI_Mm01_00061159 predicted 2668
4 SASI_Mm01_00061161 predicted 3545
5 SASI_Mm01_00061162 predicted 3019
6 SASI_Mm01_00061163 predicted 855
7 SASI_Mm02_00314770 predicted 3561
8 SASI_Mm02_00314771 predicted 990
9 SASI_Mm01_00061166 predicted 862
10 SASI_Mm02_00314772 predicted 4064
11 SASI_Mm01_00061160 predicted 2208
12 SASI_Mm01_00061164 predicted 2297
13 SASI_Mm01_00061165 predicted 2163
14 SASI_Mm01_00061167 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075903 predicted 627
2 SASI_Mm01_00075904 predicted 3086
3 SASI_Mm01_00075905 predicted 2491
4 SASI_Mm01_00075907 predicted 3372
5 SASI_Mm01_00075908 predicted 2839
6 SASI_Mm01_00075909 predicted 857
7 SASI_Mm02_00345088 predicted 3386
8 SASI_Mm02_00345089 predicted 991
9 SASI_Mm01_00075911 predicted 863
10 SASI_Mm02_00345090 predicted 3879
11 SASI_Mm01_00075906 predicted 2217
12 SASI_Mm01_00075910 predicted 2234
13 SASI_Mm01_00075912 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002637
VALIDATED
PHKA1 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, alpha 1 (muscle)
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-4035s1c1
Sequence:CCGGCCAGTGACAATCTTATGAGTACTCGAGTACTCATAAGATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3108s1c1
Sequence:CCGGGCTATTTCTATCCACGAGATTCTCGAGAATCTCGTGGATAGAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1725s1c1
Sequence:CCGGCCACAGTTTATAGACCAGCAACTCGAGTTGCTGGTCTATAAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2995s1c1
Sequence:CCGGGCCTGATGAATCTCAGTCCTTCTCGAGAAGGACTGAGATTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-2142s1c1
Sequence:CCGGGCTCGTTATTTAGATCACCTTCTCGAGAAGGTGATCTAAATAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3884s1c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2240s1c1
Sequence:CCGGGCAAACAACCTGCGACTTAATCTCGAGATTAAGTCGCAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-869s1c1
Sequence:CCGGGCACTGCCAGTCTATCCTAAACTCGAGTTTAGGATAGACTGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2131s1c1
Sequence:CCGGGTGATGAAGTTGCTCGTTATTCTCGAGAATAACGAGCAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-2496s1c1
Sequence:CCGGCAAGCTGATATCCTCTATATGCTCGAGCATATAGAGGATATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-3910s1c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3993s1c1
Sequence:CCGGGTAGAAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3561s1c1
Sequence:CCGGCTCACCATGCTGGCAGATATTCTCGAGAATATCTGCCAGCATGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-1104s1c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1612s1c1
Sequence:CCGGCCAGCCTAGGATGCAACAATACTCGAGTATTGTTGCATCCTAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4050s21c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-1244s21c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4024s21c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-3218s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-2272s21c1
Sequence:CCGGTGATGAAGTTGCTCGTTATTTCTCGAGAAATAACGAGCAACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002637
VALIDATED
PHKA1 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, alpha 1 (muscle)
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-4035s1c1
Sequence:CCGGCCAGTGACAATCTTATGAGTACTCGAGTACTCATAAGATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3108s1c1
Sequence:CCGGGCTATTTCTATCCACGAGATTCTCGAGAATCTCGTGGATAGAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1725s1c1
Sequence:CCGGCCACAGTTTATAGACCAGCAACTCGAGTTGCTGGTCTATAAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2995s1c1
Sequence:CCGGGCCTGATGAATCTCAGTCCTTCTCGAGAAGGACTGAGATTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-2142s1c1
Sequence:CCGGGCTCGTTATTTAGATCACCTTCTCGAGAAGGTGATCTAAATAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3884s1c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2240s1c1
Sequence:CCGGGCAAACAACCTGCGACTTAATCTCGAGATTAAGTCGCAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-869s1c1
Sequence:CCGGGCACTGCCAGTCTATCCTAAACTCGAGTTTAGGATAGACTGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2131s1c1
Sequence:CCGGGTGATGAAGTTGCTCGTTATTCTCGAGAATAACGAGCAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-2496s1c1
Sequence:CCGGCAAGCTGATATCCTCTATATGCTCGAGCATATAGAGGATATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-3910s1c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3993s1c1
Sequence:CCGGGTAGAAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3561s1c1
Sequence:CCGGCTCACCATGCTGGCAGATATTCTCGAGAATATCTGCCAGCATGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-1104s1c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1612s1c1
Sequence:CCGGCCAGCCTAGGATGCAACAATACTCGAGTATTGTTGCATCCTAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4050s21c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-1244s21c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4024s21c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-3218s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-2272s21c1
Sequence:CCGGTGATGAAGTTGCTCGTTATTTCTCGAGAAATAACGAGCAACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002637
VALIDATED
PHKA1 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, alpha 1 (muscle)
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-4035s1c1
Sequence:CCGGCCAGTGACAATCTTATGAGTACTCGAGTACTCATAAGATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3108s1c1
Sequence:CCGGGCTATTTCTATCCACGAGATTCTCGAGAATCTCGTGGATAGAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1725s1c1
Sequence:CCGGCCACAGTTTATAGACCAGCAACTCGAGTTGCTGGTCTATAAACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2995s1c1
Sequence:CCGGGCCTGATGAATCTCAGTCCTTCTCGAGAAGGACTGAGATTCATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-2142s1c1
Sequence:CCGGGCTCGTTATTTAGATCACCTTCTCGAGAAGGTGATCTAAATAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-3884s1c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2240s1c1
Sequence:CCGGGCAAACAACCTGCGACTTAATCTCGAGATTAAGTCGCAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-869s1c1
Sequence:CCGGGCACTGCCAGTCTATCCTAAACTCGAGTTTAGGATAGACTGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002637.1-2131s1c1
Sequence:CCGGGTGATGAAGTTGCTCGTTATTCTCGAGAATAACGAGCAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-2496s1c1
Sequence:CCGGCAAGCTGATATCCTCTATATGCTCGAGCATATAGAGGATATCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002637.1-3910s1c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3993s1c1
Sequence:CCGGGTAGAAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-3561s1c1
Sequence:CCGGCTCACCATGCTGGCAGATATTCTCGAGAATATCTGCCAGCATGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002637.1-1104s1c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002637.1-1612s1c1
Sequence:CCGGCCAGCCTAGGATGCAACAATACTCGAGTATTGTTGCATCCTAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4050s21c1
Sequence:CCGGGTTATTGCCTAATCACTCCAACTCGAGTTGGAGTGATTAGGCAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-1244s21c1
Sequence:CCGGCCAGCTGAGCTGAAGCTATTTCTCGAGAAATAGCTTCAGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002637.3-4024s21c1
Sequence:CCGGCGGTTGATTGTGCATGGAACTCTCGAGAGTTCCATGCACAATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-3218s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002637.3-2272s21c1
Sequence:CCGGTGATGAAGTTGCTCGTTATTTCTCGAGAAATAACGAGCAACTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008832
VALIDATED
PHKA1 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, alpha 1 (muscle)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-1644s1c1
Sequence:CCGGGCTCGTATTCTCAGCCATATTCTCGAGAATATGGCTGAGAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3459s1c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-2203s1c1
Sequence:CCGGCCCGTTATTTAGACCGCCTTTCTCGAGAAAGGCGGTCTAAATAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3744s1c1
Sequence:CCGGGCCAACGACTTGTTCCTTCAACTCGAGTTGAAGGAACAAGTCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008832.1-1202s1c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3563s21c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3242s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1750s21c1
Sequence:CCGGTCGTATTCTCAGCCATATTTACTCGAGTAAATATGGCTGAGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008832.2-4466s21c1
Sequence:CCGGGTATTGATTAGGCCATCATTTCTCGAGAAATGATGGCCTAATCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1306s21c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008832
VALIDATED
PHKA1 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, alpha 1 (muscle)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-1644s1c1
Sequence:CCGGGCTCGTATTCTCAGCCATATTCTCGAGAATATGGCTGAGAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3459s1c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-2203s1c1
Sequence:CCGGCCCGTTATTTAGACCGCCTTTCTCGAGAAAGGCGGTCTAAATAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3744s1c1
Sequence:CCGGGCCAACGACTTGTTCCTTCAACTCGAGTTGAAGGAACAAGTCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008832.1-1202s1c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3563s21c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3242s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1750s21c1
Sequence:CCGGTCGTATTCTCAGCCATATTTACTCGAGTAAATATGGCTGAGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008832.2-4466s21c1
Sequence:CCGGGTATTGATTAGGCCATCATTTCTCGAGAAATGATGGCCTAATCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1306s21c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008832
VALIDATED
PHKA1 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, alpha 1 (muscle)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-1644s1c1
Sequence:CCGGGCTCGTATTCTCAGCCATATTCTCGAGAATATGGCTGAGAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3459s1c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-2203s1c1
Sequence:CCGGCCCGTTATTTAGACCGCCTTTCTCGAGAAAGGCGGTCTAAATAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008832.1-3744s1c1
Sequence:CCGGGCCAACGACTTGTTCCTTCAACTCGAGTTGAAGGAACAAGTCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008832.1-1202s1c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3563s21c1
Sequence:CCGGGCACTAAATAGAGTACCAATTCTCGAGAATTGGTACTCTATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-3242s21c1
Sequence:CCGGGTTCGTCCCACTGATTCAAATCTCGAGATTTGAATCAGTGGGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1750s21c1
Sequence:CCGGTCGTATTCTCAGCCATATTTACTCGAGTAAATATGGCTGAGAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008832.2-4466s21c1
Sequence:CCGGGTATTGATTAGGCCATCATTTCTCGAGAAATGATGGCCTAATCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008832.2-1306s21c1
Sequence:CCGGGCCATTGTTCTGGACATACTTCTCGAGAAGTATGTCCAGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks