EMAIL THIS PAGE TO A FRIEND

PHLDB1

pleckstrin homology-like domain, family B, member 1

Synonyms: LL5A
UniProtKB ID: Q86UU1, B0YJ63, B0YJ64, O75133, Q4KMF8, Q8TEQ2
Gene ID:
Mouse(102693) pleckstrin homology-like domain, family B, member 1
Rat(171434) pleckstrin homology-like domain, family B, member 1
chicken(419790) pleckstrin homology-like domain, family B, member 1
Horse(100071272) pleckstrin homology-like domain, family B, member 1
domestic cat(101091807) pleckstrin homology-like domain, family B, member 1
dog(489381) pleckstrin homology-like domain, family B, member 1
naked mole-rat(101717916) pleckstrin homology-like domain, family B, member 1
Domestic Rabbit(100355993) pleckstrin homology-like domain, family B, member 1
domestic guinea pig(100724028) pleckstrin homology-like domain, family B, member 1
cow(533996) pleckstrin homology-like domain, family B, member 1
sheep(101103420) pleckstrin homology-like domain, family B, member 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015157 Rosetta Predictions human pricing
XM_001067414 Rosetta Predictions rat pricing
XM_576401 Rosetta Predictions rat pricing
NM_153537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156577 predicted 357
2 SASI_Hs02_00347120 predicted 4037
3 SASI_Hs01_00156578 predicted 447
4 SASI_Hs01_00156579 predicted 4211
5 SASI_Hs01_00156580 predicted 3979
6 SASI_Hs01_00156581 predicted 3667
7 SASI_Hs01_00156582 predicted 4211
8 SASI_Hs01_00156585 predicted 829
9 SASI_Hs01_00156586 predicted 4525
10 SASI_Hs02_00347121 predicted 4547
11 SASI_Hs01_00156583 predicted 4433
12 SASI_Hs01_00156584 predicted 4423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320924 predicted 2641
2 SASI_Rn02_00320925 predicted 1417
3 SASI_Rn02_00320926 predicted 1472
4 SASI_Rn02_00320927 predicted 3800
5 SASI_Rn02_00320928 predicted 4141
6 SASI_Rn02_00320929 predicted 4437
7 SASI_Rn02_00320930 predicted 3757
8 SASI_Rn02_00320931 predicted 4217
9 SASI_Rn02_00320932 predicted 500
10 SASI_Rn02_00320933 predicted 2548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405251 predicted 4828
2 SASI_Rn02_00405252 predicted 4824
3 SASI_Rn02_00405253 predicted 4779
4 SASI_Rn02_00405254 predicted 4798
5 SASI_Rn02_00405255 predicted 4813
6 SASI_Rn02_00405256 predicted 4805
7 SASI_Rn02_00405257 predicted 4603
8 SASI_Rn02_00405258 predicted 4518
9 SASI_Rn02_00405259 predicted 4514
10 SASI_Rn02_00405260 predicted 4552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186315 predicted 1715
2 SASI_Mm01_00186316 predicted 3963
3 SASI_Mm01_00186317 predicted 3576
4 SASI_Mm01_00186318 predicted 4181
5 SASI_Mm01_00186319 predicted 2608
6 SASI_Mm02_00343301 predicted 3966
7 SASI_Mm01_00186320 predicted 2757
8 SASI_Mm01_00186321 predicted 1167
9 SASI_Mm01_00186322 predicted 4181
10 SASI_Mm01_00186323 predicted 744
11 SASI_Mm01_00186324 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015157
VALIDATED
PHLDB1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-3609s1c1
Sequence:CCGGCTCATGCACCACTCTATCCTACTCGAGTAGGATAGAGTGGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-759s1c1
Sequence:CCGGGCTGAAGCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-449s1c1
Sequence:CCGGGCTGAAAGTGCAAACGGACAACTCGAGTTGTCCGTTTGCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015157.1-4918s1c1
Sequence:CCGGCCATTGTTCTCCTTTCCCTTACTCGAGTAAGGGAAAGGAGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-4428s1c1
Sequence:CCGGCGTATCTGGATGGATGTCATTCTCGAGAATGACATCCATCCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-2748s1c1
Sequence:CCGGGAGACTGAGACAAAGCTCTTTCTCGAGAAAGAGCTTTGTCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-834s1c1
Sequence:CCGGGCAGAATCAGAAAGTCTGGTACTCGAGTACCAGACTTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4243s21c1
Sequence:CCGGAGCTGAAGGGAGTCATCTATTCTCGAGAATAGATGACTCCCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-2204s21c1
Sequence:CCGGCCTGAACCTGTGTGCCGAATACTCGAGTATTCGGCACACAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4556s21c1
Sequence:CCGGAGCTTGGTCCTGTGAGTTTCTCTCGAGAGAAACTCACAGGACCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3067s21c1
Sequence:CCGGAGACCACATCGACCCTCAAAGCTCGAGCTTTGAGGGTCGATGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4958s21c1
Sequence:CCGGCAAGGGCCAGAGATCTCAAGTCTCGAGACTTGAGATCTCTGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4648s21c1
Sequence:CCGGAGAACTTGCAGTAACCCTTTACTCGAGTAAAGGGTTACTGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3606s21c1
Sequence:CCGGCCTCTCATGCACCACTCTATCCTCGAGGATAGAGTGGTGCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3469s21c1
Sequence:CCGGAGAAGGGACAACAAGTGATTGCTCGAGCAATCACTTGTTGTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4204s21c1
Sequence:CCGGAGCGCACCCTTTCCTATTATGCTCGAGCATAATAGGAAAGGGTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015157
VALIDATED
PHLDB1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-3609s1c1
Sequence:CCGGCTCATGCACCACTCTATCCTACTCGAGTAGGATAGAGTGGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-759s1c1
Sequence:CCGGGCTGAAGCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-449s1c1
Sequence:CCGGGCTGAAAGTGCAAACGGACAACTCGAGTTGTCCGTTTGCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015157.1-4918s1c1
Sequence:CCGGCCATTGTTCTCCTTTCCCTTACTCGAGTAAGGGAAAGGAGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-4428s1c1
Sequence:CCGGCGTATCTGGATGGATGTCATTCTCGAGAATGACATCCATCCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-2748s1c1
Sequence:CCGGGAGACTGAGACAAAGCTCTTTCTCGAGAAAGAGCTTTGTCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-834s1c1
Sequence:CCGGGCAGAATCAGAAAGTCTGGTACTCGAGTACCAGACTTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4243s21c1
Sequence:CCGGAGCTGAAGGGAGTCATCTATTCTCGAGAATAGATGACTCCCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-2204s21c1
Sequence:CCGGCCTGAACCTGTGTGCCGAATACTCGAGTATTCGGCACACAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4556s21c1
Sequence:CCGGAGCTTGGTCCTGTGAGTTTCTCTCGAGAGAAACTCACAGGACCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3067s21c1
Sequence:CCGGAGACCACATCGACCCTCAAAGCTCGAGCTTTGAGGGTCGATGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4958s21c1
Sequence:CCGGCAAGGGCCAGAGATCTCAAGTCTCGAGACTTGAGATCTCTGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4648s21c1
Sequence:CCGGAGAACTTGCAGTAACCCTTTACTCGAGTAAAGGGTTACTGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3606s21c1
Sequence:CCGGCCTCTCATGCACCACTCTATCCTCGAGGATAGAGTGGTGCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3469s21c1
Sequence:CCGGAGAAGGGACAACAAGTGATTGCTCGAGCAATCACTTGTTGTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4204s21c1
Sequence:CCGGAGCGCACCCTTTCCTATTATGCTCGAGCATAATAGGAAAGGGTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015157
VALIDATED
PHLDB1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-3609s1c1
Sequence:CCGGCTCATGCACCACTCTATCCTACTCGAGTAGGATAGAGTGGTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-759s1c1
Sequence:CCGGGCTGAAGCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015157.1-449s1c1
Sequence:CCGGGCTGAAAGTGCAAACGGACAACTCGAGTTGTCCGTTTGCACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015157.1-4918s1c1
Sequence:CCGGCCATTGTTCTCCTTTCCCTTACTCGAGTAAGGGAAAGGAGAACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-4428s1c1
Sequence:CCGGCGTATCTGGATGGATGTCATTCTCGAGAATGACATCCATCCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-2748s1c1
Sequence:CCGGGAGACTGAGACAAAGCTCTTTCTCGAGAAAGAGCTTTGTCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015157.1-834s1c1
Sequence:CCGGGCAGAATCAGAAAGTCTGGTACTCGAGTACCAGACTTTCTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4243s21c1
Sequence:CCGGAGCTGAAGGGAGTCATCTATTCTCGAGAATAGATGACTCCCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-2204s21c1
Sequence:CCGGCCTGAACCTGTGTGCCGAATACTCGAGTATTCGGCACACAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4556s21c1
Sequence:CCGGAGCTTGGTCCTGTGAGTTTCTCTCGAGAGAAACTCACAGGACCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3067s21c1
Sequence:CCGGAGACCACATCGACCCTCAAAGCTCGAGCTTTGAGGGTCGATGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4958s21c1
Sequence:CCGGCAAGGGCCAGAGATCTCAAGTCTCGAGACTTGAGATCTCTGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015157.2-4648s21c1
Sequence:CCGGAGAACTTGCAGTAACCCTTTACTCGAGTAAAGGGTTACTGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3606s21c1
Sequence:CCGGCCTCTCATGCACCACTCTATCCTCGAGGATAGAGTGGTGCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-3469s21c1
Sequence:CCGGAGAAGGGACAACAAGTGATTGCTCGAGCAATCACTTGTTGTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015157.2-4204s21c1
Sequence:CCGGAGCGCACCCTTTCCTATTATGCTCGAGCATAATAGGAAAGGGTGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153537
VALIDATED
PHLDB1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153537.3-5141s1c1
Sequence:CCGGCCTCCCATTCTAACAGGACTACTCGAGTAGTCCTGTTAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-4180s1c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-1179s1c1
Sequence:CCGGGCCTGAGTGAATACCCATCTTCTCGAGAAGATGGGTATTCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-682s1c1
Sequence:CCGGGCAGGAAATCATGGATTCATTCTCGAGAATGAATCCATGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153537.3-2990s1c1
Sequence:CCGGCGCTCCAAGATGGATAGTGATCTCGAGATCACTATCCATCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-4180s21c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-952s21c1
Sequence:CCGGCCGCTCCTCTAGCTACCATTTCTCGAGAAATGGTAGCTAGAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-1833s21c1
Sequence:CCGGTCACGGAGATCAGCGACAATGCTCGAGCATTGTCGCTGATCTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-4355s21c1
Sequence:CCGGCAAGAAGACAAATTGTGTTATCTCGAGATAACACAATTTGTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-469s21c1
Sequence:CCGGATCCACCTTCCTGCGCTTTAACTCGAGTTAAAGCGCAGGAAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153537
VALIDATED
PHLDB1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153537.3-5141s1c1
Sequence:CCGGCCTCCCATTCTAACAGGACTACTCGAGTAGTCCTGTTAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-4180s1c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-1179s1c1
Sequence:CCGGGCCTGAGTGAATACCCATCTTCTCGAGAAGATGGGTATTCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-682s1c1
Sequence:CCGGGCAGGAAATCATGGATTCATTCTCGAGAATGAATCCATGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153537.3-2990s1c1
Sequence:CCGGCGCTCCAAGATGGATAGTGATCTCGAGATCACTATCCATCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-4180s21c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-952s21c1
Sequence:CCGGCCGCTCCTCTAGCTACCATTTCTCGAGAAATGGTAGCTAGAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-1833s21c1
Sequence:CCGGTCACGGAGATCAGCGACAATGCTCGAGCATTGTCGCTGATCTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-4355s21c1
Sequence:CCGGCAAGAAGACAAATTGTGTTATCTCGAGATAACACAATTTGTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-469s21c1
Sequence:CCGGATCCACCTTCCTGCGCTTTAACTCGAGTTAAAGCGCAGGAAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153537
VALIDATED
PHLDB1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153537.3-5141s1c1
Sequence:CCGGCCTCCCATTCTAACAGGACTACTCGAGTAGTCCTGTTAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-4180s1c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-1179s1c1
Sequence:CCGGGCCTGAGTGAATACCCATCTTCTCGAGAAGATGGGTATTCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153537.3-682s1c1
Sequence:CCGGGCAGGAAATCATGGATTCATTCTCGAGAATGAATCCATGATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153537.3-2990s1c1
Sequence:CCGGCGCTCCAAGATGGATAGTGATCTCGAGATCACTATCCATCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-4180s21c1
Sequence:CCGGCGAGGGCTACACTCAATTCATCTCGAGATGAATTGAGTGTAGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-952s21c1
Sequence:CCGGCCGCTCCTCTAGCTACCATTTCTCGAGAAATGGTAGCTAGAGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153537.3-1833s21c1
Sequence:CCGGTCACGGAGATCAGCGACAATGCTCGAGCATTGTCGCTGATCTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-4355s21c1
Sequence:CCGGCAAGAAGACAAATTGTGTTATCTCGAGATAACACAATTTGTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153537.3-469s21c1
Sequence:CCGGATCCACCTTCCTGCGCTTTAACTCGAGTTAAAGCGCAGGAAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks