EMAIL THIS PAGE TO A FRIEND

PHLPP2

PH domain and leucine rich repeat protein phosphatase 2

Synonyms: PHLPPL
UniProtKB ID: Q6ZVD8, A1L374, Q9NV17, Q9Y2E3
Gene ID:
Mouse(244650) PH domain and leucine rich repeat protein phosphatase 2
Rat(498949) PH domain and leucine rich repeat protein phosphatase 2
naked mole-rat(101699656) PH domain and leucine rich repeat protein phosphatase 2
Domestic Rabbit(100356030) PH domain and leucine rich repeat protein phosphatase 2
domestic guinea pig(100729093) PH domain and leucine rich repeat protein phosphatase 2
cow(533130) PH domain and leucine rich repeat protein phosphatase 2
sheep(101104420) PH domain and leucine rich repeat protein phosphatase 2
Zebrafish(100101638) PH domain and leucine rich repeat protein phosphatase 2
Horse(100054529) PH domain and leucine rich repeat protein phosphatase 2
domestic cat(101080345) PH domain and leucine rich repeat protein phosphatase 2
dog(489724) PH domain and leucine rich repeat protein phosphatase 2
chicken(415881) PH domain and leucine rich repeat protein phosphatase 2
228 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_041191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_041191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_041191 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_146511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_146511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_146511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015020 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015020 Rosetta Predictions human pricing
NM_001109131 Rosetta Predictions rat pricing
XM_574238 Rosetta Predictions rat pricing
NM_001122594 Rosetta Predictions mouse pricing
XM_146511 Rosetta Predictions mouse pricing
XM_902366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116291 predicted 1800
2 SASI_Hs01_00116292 predicted 945
3 SASI_Hs02_00346804 predicted 1131
4 SASI_Hs02_00346805 predicted 1404
5 SASI_Hs01_00116293 predicted 3585
6 SASI_Hs01_00116295 predicted 463
7 SASI_Hs01_00116296 predicted 2976
8 SASI_Hs01_00116297 predicted 1600
9 SASI_Hs01_00116298 predicted 1883
10 SASI_Hs01_00116299 predicted 1368
11 SASI_Hs01_00116290 predicted 1271
12 SASI_Hs01_00116294 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245430 predicted 1665
2 SASI_Rn02_00245431 predicted 639
3 SASI_Rn02_00245432 predicted 2196
4 SASI_Rn02_00245433 predicted 1148
5 SASI_Rn02_00245434 predicted 1611
6 SASI_Rn02_00245435 predicted 1967
7 SASI_Rn02_00245436 predicted 2053
8 SASI_Rn02_00245437 predicted 2705
9 SASI_Rn02_00245438 predicted 1362
10 SASI_Rn02_00245439 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125768 predicted 575
2 SASI_Rn01_00125769 predicted 1110
3 SASI_Rn01_00125770 predicted 659
4 SASI_Rn01_00125771 predicted 584
5 SASI_Rn01_00125772 predicted 1063
6 SASI_Rn01_00125773 predicted 1105
7 SASI_Rn01_00125774 predicted 925
8 SASI_Rn01_00125775 predicted 908
9 SASI_Rn01_00125776 predicted 658
10 SASI_Rn01_00125777 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309027 predicted 777
2 SASI_Mm02_00309028 predicted 2281
3 SASI_Mm02_00309029 predicted 576
4 SASI_Mm02_00309030 predicted 3095
5 SASI_Mm02_00309031 predicted 4078
6 SASI_Mm02_00309032 predicted 2125
7 SASI_Mm02_00309033 predicted 1224
8 SASI_Mm02_00309034 predicted 2765
9 SASI_Mm02_00309035 predicted 3731
10 SASI_Mm02_00309036 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282470 predicted 1190
2 SASI_Mm01_00282471 predicted 841
3 SASI_Mm01_00282472 predicted 628
4 SASI_Mm01_00282473 predicted 1155
5 SASI_Mm01_00282474 predicted 705
6 SASI_Mm01_00282475 predicted 729
7 SASI_Mm01_00282476 predicted 1284
8 SASI_Mm01_00282477 predicted 3793
9 SASI_Mm01_00282478 predicted 618
10 SASI_Mm01_00282479 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216094 predicted 483
2 SASI_Mm01_00216095 predicted 635
3 SASI_Mm01_00216096 predicted 422
4 SASI_Mm01_00216097 predicted 715
5 SASI_Mm01_00216098 predicted 735
6 SASI_Mm01_00216099 predicted 1028
7 SASI_Mm01_00216100 predicted 718
8 SASI_Mm01_00216101 predicted 1021
9 SASI_Mm01_00216102 predicted 1078
10 SASI_Mm01_00216103 predicted 184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_041191
VALIDATED
PHLPP2 MISSION shRNA Bacterial Glycerol Stock
PH domain and leucine rich repeat protein phosphatase 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000082658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-5528s1c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-2249s1c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1287s1c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1251s1c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_041191
VALIDATED
PHLPP2 MISSION shRNA shRNA Plasmid DNA
PH domain and leucine rich repeat protein phosphatase 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000082658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-5528s1c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-2249s1c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1287s1c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1251s1c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_041191
VALIDATED
PHLPP2 MISSION shRNA Lentiviral Transduction Particles
PH domain and leucine rich repeat protein phosphatase 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000082658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-5528s1c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-2249s1c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1287s1c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_041191.6-1251s1c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_146511
VALIDATED
PHLPP2 MISSION shRNA Bacterial Glycerol Stock
PH domain and leucine rich repeat protein phosphatase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2128s1c1
Sequence:CCGGGCTGAATCTAAGTGGGAACAACTCGAGTTGTTCCCACTTAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2318s1c1
Sequence:CCGGGCTACTTTACAAGACCTTGATCTCGAGATCAAGGTCTTGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-652s1c1
Sequence:CCGGCCTTATTGTTTCCTCAGTGAACTCGAGTTCACTGAGGAAACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2770s1c1
Sequence:CCGGCCCAACAAGTAGCTTTAGCTTCTCGAGAAGCTAAAGCTACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-424s1c1
Sequence:CCGGCCAGATTGTTTACGATTACTTCTCGAGAAGTAATCGTAAACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_146511
VALIDATED
PHLPP2 MISSION shRNA shRNA Plasmid DNA
PH domain and leucine rich repeat protein phosphatase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2128s1c1
Sequence:CCGGGCTGAATCTAAGTGGGAACAACTCGAGTTGTTCCCACTTAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2318s1c1
Sequence:CCGGGCTACTTTACAAGACCTTGATCTCGAGATCAAGGTCTTGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-652s1c1
Sequence:CCGGCCTTATTGTTTCCTCAGTGAACTCGAGTTCACTGAGGAAACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2770s1c1
Sequence:CCGGCCCAACAAGTAGCTTTAGCTTCTCGAGAAGCTAAAGCTACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-424s1c1
Sequence:CCGGCCAGATTGTTTACGATTACTTCTCGAGAAGTAATCGTAAACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_146511
VALIDATED
PHLPP2 MISSION shRNA Lentiviral Transduction Particles
PH domain and leucine rich repeat protein phosphatase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2128s1c1
Sequence:CCGGGCTGAATCTAAGTGGGAACAACTCGAGTTGTTCCCACTTAGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2318s1c1
Sequence:CCGGGCTACTTTACAAGACCTTGATCTCGAGATCAAGGTCTTGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-652s1c1
Sequence:CCGGCCTTATTGTTTCCTCAGTGAACTCGAGTTCACTGAGGAAACAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-2770s1c1
Sequence:CCGGCCCAACAAGTAGCTTTAGCTTCTCGAGAAGCTAAAGCTACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146511.4-424s1c1
Sequence:CCGGCCAGATTGTTTACGATTACTTCTCGAGAAGTAATCGTAAACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015020
PHLPP2 MISSION shRNA Bacterial Glycerol Stock
PH domain and leucine rich repeat protein phosphatase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-1876s21c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-914s21c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015020.2-5155s21c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-313s21c1
Sequence:CCGGCCTCTTCAGATCGTTTATGATCTCGAGATCATAAACGATCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-878s21c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015020
PHLPP2 MISSION shRNA shRNA Plasmid DNA
PH domain and leucine rich repeat protein phosphatase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-1876s21c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-914s21c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015020.2-5155s21c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-313s21c1
Sequence:CCGGCCTCTTCAGATCGTTTATGATCTCGAGATCATAAACGATCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-878s21c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015020
PHLPP2 MISSION shRNA Lentiviral Transduction Particles
PH domain and leucine rich repeat protein phosphatase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-1876s21c1
Sequence:CCGGCTGCTTTATCTGACCAACAATCTCGAGATTGTTGGTCAGATAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-914s21c1
Sequence:CCGGGCCTGAACTTGTCCCATAATACTCGAGTATTATGGGACAAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015020.2-5155s21c1
Sequence:CCGGGCTAGGTATTTCCCAGGGAAACTCGAGTTTCCCTGGGAAATACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-313s21c1
Sequence:CCGGCCTCTTCAGATCGTTTATGATCTCGAGATCATAAACGATCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015020.2-878s21c1
Sequence:CCGGGCCTCGATACACTCTACAAATCTCGAGATTTGTAGAGTGTATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks