EMAIL THIS PAGE TO A FRIEND

PI4K2A

phosphatidylinositol 4-kinase type 2 alpha

Synonyms: PI4KII PIK42A RP11-548K23.6
UniProtKB ID: Q9BTU6, D3DR59, Q9NSG8
Gene ID:
Human(55361) Summary: Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]
Mouse(84095) phosphatidylinositol 4-kinase type 2 alpha
Rat(114554) phosphatidylinositol 4-kinase type 2 alpha
domestic guinea pig(100721302) phosphatidylinositol 4-kinase type 2 alpha
naked mole-rat(101701668) phosphatidylinositol 4-kinase type 2 alpha
Domestic Rabbit(100350197) phosphatidylinositol 4-kinase type 2 alpha
cow(507860) phosphatidylinositol 4-kinase type 2 alpha
Goat(100861268) phosphatidylinositol 4-kinase type 2 alpha
sheep(101115415) phosphatidylinositol 4-kinase type 2 alpha
Zebrafish(406667) phosphatidylinositol 4-kinase type 2 alpha
domestic cat(101088190) phosphatidylinositol 4-kinase type 2 alpha
Horse(100070680) phosphatidylinositol 4-kinase type 2 alpha
dog(486824) phosphatidylinositol 4-kinase type 2 alpha
chicken(425291) phosphatidylinositol 4-kinase type 2 alpha
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129641 MISSION® esiRNA esiRNA human PI4K2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018425 Rosetta Predictions human pricing
NM_053735 Rosetta Predictions rat pricing
NM_145501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190417 predicted 980
2 SASI_Hs01_00190418 predicted 849
3 SASI_Hs01_00190419 predicted 484
4 SASI_Hs01_00190420 predicted 1249
5 SASI_Hs01_00190421 predicted 787
6 SASI_Hs01_00190422 predicted 537
7 SASI_Hs01_00190423 predicted 817
8 SASI_Hs01_00190424 predicted 812
9 SASI_Hs01_00190425 predicted 863
10 SASI_Hs01_00190426 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031716 predicted 587
2 SASI_Rn01_00031717 predicted 846
3 SASI_Rn01_00031718 predicted 701
4 SASI_Rn01_00031719 predicted 818
5 SASI_Rn01_00031720 predicted 418
6 SASI_Rn01_00031722 predicted 786
7 SASI_Rn02_00266516 predicted 1315
8 SASI_Rn01_00031723 predicted 1090
9 SASI_Rn01_00031724 predicted 857
10 SASI_Rn02_00266517 predicted 810
11 SASI_Rn01_00031721 predicted 991
12 SASI_Rn01_00031725 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134990 predicted 1329
2 SASI_Mm01_00134991 predicted 838
3 SASI_Mm01_00134992 predicted 679
4 SASI_Mm01_00134993 predicted 544
5 SASI_Mm01_00134994 predicted 437
6 SASI_Mm01_00134995 predicted 729
7 SASI_Mm02_00340948 predicted 912
8 SASI_Mm01_00134996 predicted 1261
9 SASI_Mm01_00134997 predicted 470
10 SASI_Mm01_00134998 predicted 876
11 SASI_Mm01_00134999 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145501
VALIDATED
PI4K2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase type 2 alpha
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-969s21c1
Sequence:CCGGACTACATCATCCGCAACACTGCTCGAGCAGTGTTGCGGATGATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-542s21c1
Sequence:CCGGTACGGGCACCTTAACCCTAAGCTCGAGCTTAGGGTTAAGGTGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-737s21c1
Sequence:CCGGAGTGCCATTGATCGAGTAAAGCTCGAGCTTTACTCGATCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-439s21c1
Sequence:CCGGCATCTATCCCGAGCGCATCTACTCGAGTAGATGCGCTCGGGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-852s21c1
Sequence:CCGGTCTTCGTTGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCAACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145501.2-1934s21c1
Sequence:CCGGGCCCTTAATCTAGAACCTAAACTCGAGTTTAGGTTCTAGATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1162s1c1
Sequence:CCGGCCGTTCTCTCAGGAGATCAAACTCGAGTTTGATCTCCTGAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-496s1c1
Sequence:CCGGCCCAAGAATGAAGAGCCATATCTCGAGATATGGCTCTTCATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-663s1c1
Sequence:CCGGACCACGTACAAAGGTAGTATACTCGAGTATACTACCTTTGTACGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-909s1c1
Sequence:CCGGGCTATTGCAGTTTGAGCGGTTCTCGAGAACCGCTCAAACTGCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1332s1c1
Sequence:CCGGCCAGGCCCTGAAAGACAATAACTCGAGTTATTGTCTTTCAGGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145501
VALIDATED
PI4K2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase type 2 alpha
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-969s21c1
Sequence:CCGGACTACATCATCCGCAACACTGCTCGAGCAGTGTTGCGGATGATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-542s21c1
Sequence:CCGGTACGGGCACCTTAACCCTAAGCTCGAGCTTAGGGTTAAGGTGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-737s21c1
Sequence:CCGGAGTGCCATTGATCGAGTAAAGCTCGAGCTTTACTCGATCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-439s21c1
Sequence:CCGGCATCTATCCCGAGCGCATCTACTCGAGTAGATGCGCTCGGGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-852s21c1
Sequence:CCGGTCTTCGTTGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCAACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145501.2-1934s21c1
Sequence:CCGGGCCCTTAATCTAGAACCTAAACTCGAGTTTAGGTTCTAGATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1162s1c1
Sequence:CCGGCCGTTCTCTCAGGAGATCAAACTCGAGTTTGATCTCCTGAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-496s1c1
Sequence:CCGGCCCAAGAATGAAGAGCCATATCTCGAGATATGGCTCTTCATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-663s1c1
Sequence:CCGGACCACGTACAAAGGTAGTATACTCGAGTATACTACCTTTGTACGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-909s1c1
Sequence:CCGGGCTATTGCAGTTTGAGCGGTTCTCGAGAACCGCTCAAACTGCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1332s1c1
Sequence:CCGGCCAGGCCCTGAAAGACAATAACTCGAGTTATTGTCTTTCAGGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145501
VALIDATED
PI4K2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase type 2 alpha
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-969s21c1
Sequence:CCGGACTACATCATCCGCAACACTGCTCGAGCAGTGTTGCGGATGATGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-542s21c1
Sequence:CCGGTACGGGCACCTTAACCCTAAGCTCGAGCTTAGGGTTAAGGTGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-737s21c1
Sequence:CCGGAGTGCCATTGATCGAGTAAAGCTCGAGCTTTACTCGATCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-439s21c1
Sequence:CCGGCATCTATCCCGAGCGCATCTACTCGAGTAGATGCGCTCGGGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145501.2-852s21c1
Sequence:CCGGTCTTCGTTGAAGGCTACAAAGCTCGAGCTTTGTAGCCTTCAACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145501.2-1934s21c1
Sequence:CCGGGCCCTTAATCTAGAACCTAAACTCGAGTTTAGGTTCTAGATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1162s1c1
Sequence:CCGGCCGTTCTCTCAGGAGATCAAACTCGAGTTTGATCTCCTGAGAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-496s1c1
Sequence:CCGGCCCAAGAATGAAGAGCCATATCTCGAGATATGGCTCTTCATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-663s1c1
Sequence:CCGGACCACGTACAAAGGTAGTATACTCGAGTATACTACCTTTGTACGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145501.1-909s1c1
Sequence:CCGGGCTATTGCAGTTTGAGCGGTTCTCGAGAACCGCTCAAACTGCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145501.1-1332s1c1
Sequence:CCGGCCAGGCCCTGAAAGACAATAACTCGAGTTATTGTCTTTCAGGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018425
VALIDATED
PI4K2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase type 2 alpha
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-131s1c1
Sequence:CCGGGCGCTCACTTTCCGCAGGTGCCTCGAGGCACCTGCGGAAAGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-2242s1c1
Sequence:CCGGGAGCTAGTCTTAGCATTTATACTCGAGTATAAATGCTAAGACTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-4033s1c1
Sequence:CCGGGATAGGAAGCTATGGGTAATTCTCGAGAATTACCCATAGCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-1012s1c1
Sequence:CCGGGACTGTCCAATGGATAGTTCTCTCGAGAGAACTATCCATTGGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-708s1c1
Sequence:CCGGCAGTGAGACCTTCAACTATAGCTCGAGCTATAGTTGAAGGTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018425.2-987s1c1
Sequence:CCGGCAATGACAACTGGCTGATTAACTCGAGTTAATCAGCCAGTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-898s1c1
Sequence:CCGGCCTCTTCCTGAGAACACTAACCTCGAGGTTAGTGTTCTCAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-683s1c1
Sequence:CCGGCCCGTACAAAGGTAGTATACCCTCGAGGGTATACTACCTTTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-854s1c1
Sequence:CCGGGCTACAAAGATGCAGACTATTCTCGAGAATAGTCTGCATCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018425.2-1227s1c1
Sequence:CCGGCCCTAACTTCGTCAAGGACTTCTCGAGAAGTCCTTGACGAAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-1305s1c1
Sequence:CCGGCCATAAGCAGATTGCTGTCATCTCGAGATGACAGCAATCTGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-954s1c1
Sequence:CCGGGCTGGATTACATCATCCGCAACTCGAGTTGCGGATGATGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-607s1c1
Sequence:CCGGCTTGTCCTTAACCAGGGCTATCTCGAGATAGCCCTGGTTAAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-840s1c1
Sequence:CCGGGCTCTTTGTTGAAGGCTACAACTCGAGTTGTAGCCTTCAACAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018425
VALIDATED
PI4K2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase type 2 alpha
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-131s1c1
Sequence:CCGGGCGCTCACTTTCCGCAGGTGCCTCGAGGCACCTGCGGAAAGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-2242s1c1
Sequence:CCGGGAGCTAGTCTTAGCATTTATACTCGAGTATAAATGCTAAGACTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-4033s1c1
Sequence:CCGGGATAGGAAGCTATGGGTAATTCTCGAGAATTACCCATAGCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-1012s1c1
Sequence:CCGGGACTGTCCAATGGATAGTTCTCTCGAGAGAACTATCCATTGGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-708s1c1
Sequence:CCGGCAGTGAGACCTTCAACTATAGCTCGAGCTATAGTTGAAGGTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018425.2-987s1c1
Sequence:CCGGCAATGACAACTGGCTGATTAACTCGAGTTAATCAGCCAGTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-898s1c1
Sequence:CCGGCCTCTTCCTGAGAACACTAACCTCGAGGTTAGTGTTCTCAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-683s1c1
Sequence:CCGGCCCGTACAAAGGTAGTATACCCTCGAGGGTATACTACCTTTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-854s1c1
Sequence:CCGGGCTACAAAGATGCAGACTATTCTCGAGAATAGTCTGCATCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018425.2-1227s1c1
Sequence:CCGGCCCTAACTTCGTCAAGGACTTCTCGAGAAGTCCTTGACGAAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-1305s1c1
Sequence:CCGGCCATAAGCAGATTGCTGTCATCTCGAGATGACAGCAATCTGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-954s1c1
Sequence:CCGGGCTGGATTACATCATCCGCAACTCGAGTTGCGGATGATGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-607s1c1
Sequence:CCGGCTTGTCCTTAACCAGGGCTATCTCGAGATAGCCCTGGTTAAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-840s1c1
Sequence:CCGGGCTCTTTGTTGAAGGCTACAACTCGAGTTGTAGCCTTCAACAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018425
VALIDATED
PI4K2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase type 2 alpha
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-131s1c1
Sequence:CCGGGCGCTCACTTTCCGCAGGTGCCTCGAGGCACCTGCGGAAAGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-2242s1c1
Sequence:CCGGGAGCTAGTCTTAGCATTTATACTCGAGTATAAATGCTAAGACTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018425.2-4033s1c1
Sequence:CCGGGATAGGAAGCTATGGGTAATTCTCGAGAATTACCCATAGCTTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-1012s1c1
Sequence:CCGGGACTGTCCAATGGATAGTTCTCTCGAGAGAACTATCCATTGGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-708s1c1
Sequence:CCGGCAGTGAGACCTTCAACTATAGCTCGAGCTATAGTTGAAGGTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018425.2-987s1c1
Sequence:CCGGCAATGACAACTGGCTGATTAACTCGAGTTAATCAGCCAGTTGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-898s1c1
Sequence:CCGGCCTCTTCCTGAGAACACTAACCTCGAGGTTAGTGTTCTCAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018425.2-683s1c1
Sequence:CCGGCCCGTACAAAGGTAGTATACCCTCGAGGGTATACTACCTTTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-854s1c1
Sequence:CCGGGCTACAAAGATGCAGACTATTCTCGAGAATAGTCTGCATCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018425.2-1227s1c1
Sequence:CCGGCCCTAACTTCGTCAAGGACTTCTCGAGAAGTCCTTGACGAAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-1305s1c1
Sequence:CCGGCCATAAGCAGATTGCTGTCATCTCGAGATGACAGCAATCTGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-954s1c1
Sequence:CCGGGCTGGATTACATCATCCGCAACTCGAGTTGCGGATGATGTAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018425.2-607s1c1
Sequence:CCGGCTTGTCCTTAACCAGGGCTATCTCGAGATAGCCCTGGTTAAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_018425.2-840s1c1
Sequence:CCGGGCTCTTTGTTGAAGGCTACAACTCGAGTTGTAGCCTTCAACAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks