EMAIL THIS PAGE TO A FRIEND

PI4KA

phosphatidylinositol 4-kinase, catalytic, alpha

Synonyms: PI4K-ALPHA PIK4CA pi4K230
UniProtKB ID: P42356, Q7Z625, Q9UPG2
Gene ID:
Human(5297) Summary: This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(224020) phosphatidylinositol 4-kinase, catalytic, alpha polypeptide
Rat(64161) phosphatidylinositol 4-kinase, catalytic, alpha
domestic guinea pig(101789250) phosphatidylinositol 4-kinase, catalytic, alpha
naked mole-rat(101707981) phosphatidylinositol 4-kinase, catalytic, alpha
Domestic Rabbit(100343247) phosphatidylinositol 4-kinase, catalytic, alpha
cow(282309) phosphatidylinositol 4-kinase, catalytic, alpha
sheep(101117020) phosphatidylinositol 4-kinase, catalytic, alpha
chicken(416767) phosphatidylinositol 4-kinase, catalytic, alpha
domestic cat(101090807) phosphatidylinositol 4-kinase, catalytic, alpha
Horse(100057017) phosphatidylinositol 4-kinase, catalytic, alpha
dog(486443) phosphatidylinositol 4-kinase, catalytic, alpha
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002650 Rosetta Predictions human pricing
NM_058004 Rosetta Predictions human pricing
XM_001721947 Rosetta Predictions human pricing
NM_022301 Rosetta Predictions rat pricing
NM_001001983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334185 predicted 1616
2 SASI_Hs02_00334186 predicted 2239
3 SASI_Hs02_00334187 predicted 484
4 SASI_Hs02_00334188 predicted 2098
5 SASI_Hs02_00334189 predicted 1800
6 SASI_Hs02_00334190 predicted 2271
7 SASI_Hs01_00189448 predicted 1114
8 SASI_Hs02_00334191 predicted 2287
9 SASI_Hs02_00334192 predicted 1775
10 SASI_Hs01_00189452 predicted 1111
11 SASI_Hs01_00189449 predicted 1438
12 SASI_Hs01_00189450 predicted 1376
13 SASI_Hs01_00189451 predicted 1447
14 SASI_Hs01_00189453 predicted 775
15 SASI_Hs01_00189454 predicted 1136
16 SASI_Hs01_00189455 predicted 1444
17 SASI_Hs01_00189456 predicted 1910
18 SASI_Hs01_00189457 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362056 predicted 5300
2 SASI_Hs02_00362057 predicted 5920
3 SASI_Hs02_00362058 predicted 4164
4 SASI_Hs02_00362059 predicted 5786
5 SASI_Hs02_00362060 predicted 5488
6 SASI_Hs02_00362061 predicted 5957
7 SASI_Hs01_00190126 predicted 4803
8 SASI_Hs02_00362062 predicted 5971
9 SASI_Hs02_00362063 predicted 5458
10 SASI_Hs01_00190130 predicted 4795
11 SASI_Hs01_00190127 predicted 4900
12 SASI_Hs01_00190128 predicted 4831
13 SASI_Hs01_00190129 predicted 4904
14 SASI_Hs01_00190131 predicted 4220
15 SASI_Hs01_00190132 predicted 4596
16 SASI_Hs01_00190133 predicted 4893
17 SASI_Hs01_00190134 predicted 5361
18 SASI_Hs01_00190135 predicted 4828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446105 predicted 5327
2 SASI_Hs02_00446106 predicted 2814
3 SASI_Hs02_00446107 predicted 5953
4 SASI_Hs02_00446108 predicted 4191
5 SASI_Hs02_00446109 predicted 5812
6 SASI_Hs02_00446110 predicted 1700
7 SASI_Hs02_00446111 predicted 3489
8 SASI_Hs02_00446112 predicted 3154
9 SASI_Hs02_00446113 predicted 2346
10 SASI_Hs02_00446114 predicted 5485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062353 predicted 496
2 SASI_Rn01_00062354 predicted 520
3 SASI_Rn01_00062355 predicted 4135
4 SASI_Rn01_00062356 predicted 4064
5 SASI_Rn01_00062359 predicted 1750
6 SASI_Rn02_00263125 predicted 3010
7 SASI_Rn01_00062360 predicted 4739
8 SASI_Rn01_00062362 predicted 1917
9 SASI_Rn02_00263126 predicted 1213
10 SASI_Rn02_00263127 predicted 4691
11 SASI_Rn01_00062357 predicted 5118
12 SASI_Rn01_00062358 predicted 4071
13 SASI_Rn01_00062361 predicted 4900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146330 predicted 480
2 SASI_Mm01_00146331 predicted 4033
3 SASI_Mm01_00146332 predicted 5046
4 SASI_Mm01_00146334 predicted 1523
5 SASI_Mm01_00146335 predicted 1947
6 SASI_Mm01_00146336 predicted 2195
7 SASI_Mm02_00286253 predicted 2285
8 SASI_Mm01_00146337 predicted 2990
9 SASI_Mm01_00146338 predicted 2411
10 SASI_Mm01_00146339 predicted 2059
11 SASI_Mm01_00146333 predicted 4052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002650
VALIDATED
PI4KA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase, catalytic, alpha
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002650.2-2716s21c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-721s21c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-876s21c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-2642s1c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-1372s1c1
Sequence:CCGGGGCTATGTGCGGGAGTATATTCTCGAGAATATACTCCCGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-2642s21c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-2716s1c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-721s1c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002650.1-1051s1c1
Sequence:CCGGGCCAGGTTTAAGAACACAGAACTCGAGTTCTGTGTTCTTAAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-876s1c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-2535s1c1
Sequence:CCGGCAAGCTCTTGAAGCACAGGTTCTCGAGAACCTGTGCTTCAAGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-1428s1c1
Sequence:CCGGCCAGTTCATCTGGAACATGAACTCGAGTTCATGTTCCAGATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-813s1c1
Sequence:CCGGGCTGCACAAATACTACATGAACTCGAGTTCATGTAGTATTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002650
VALIDATED
PI4KA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase, catalytic, alpha
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002650.2-2716s21c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-721s21c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-876s21c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-2642s1c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-1372s1c1
Sequence:CCGGGGCTATGTGCGGGAGTATATTCTCGAGAATATACTCCCGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-2642s21c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-2716s1c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-721s1c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002650.1-1051s1c1
Sequence:CCGGGCCAGGTTTAAGAACACAGAACTCGAGTTCTGTGTTCTTAAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-876s1c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-2535s1c1
Sequence:CCGGCAAGCTCTTGAAGCACAGGTTCTCGAGAACCTGTGCTTCAAGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-1428s1c1
Sequence:CCGGCCAGTTCATCTGGAACATGAACTCGAGTTCATGTTCCAGATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-813s1c1
Sequence:CCGGGCTGCACAAATACTACATGAACTCGAGTTCATGTAGTATTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002650
VALIDATED
PI4KA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase, catalytic, alpha
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002650.2-2716s21c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-721s21c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-876s21c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-2642s1c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.2-1372s1c1
Sequence:CCGGGGCTATGTGCGGGAGTATATTCTCGAGAATATACTCCCGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002650.2-2642s21c1
Sequence:CCGGACGACATGATCCAGTACTATCCTCGAGGATAGTACTGGATCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-2716s1c1
Sequence:CCGGCCCTCAAAGCTGTCCCACAATCTCGAGATTGTGGGACAGCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002650.1-721s1c1
Sequence:CCGGCAAGGCTGGATCAACACATACCTCGAGGTATGTGTTGATCCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002650.1-1051s1c1
Sequence:CCGGGCCAGGTTTAAGAACACAGAACTCGAGTTCTGTGTTCTTAAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-876s1c1
Sequence:CCGGGCGTCTCATCACATGGTACAACTCGAGTTGTACCATGTGATGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-2535s1c1
Sequence:CCGGCAAGCTCTTGAAGCACAGGTTCTCGAGAACCTGTGCTTCAAGAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-1428s1c1
Sequence:CCGGCCAGTTCATCTGGAACATGAACTCGAGTTCATGTTCCAGATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002650.1-813s1c1
Sequence:CCGGGCTGCACAAATACTACATGAACTCGAGTTCATGTAGTATTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001983
VALIDATED
PI4KA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase, catalytic, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-4959s21c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-5339s21c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-1302s21c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001983.1-6236s21c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-6236s1c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-4959s1c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001983.1-2493s1c1
Sequence:CCGGGCTCCGAAGTACCATCATCAACTCGAGTTGATGATGGTACTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-5339s1c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-1302s1c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001983
VALIDATED
PI4KA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase, catalytic, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-4959s21c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-5339s21c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-1302s21c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001983.1-6236s21c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-6236s1c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-4959s1c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001983.1-2493s1c1
Sequence:CCGGGCTCCGAAGTACCATCATCAACTCGAGTTGATGATGGTACTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-5339s1c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-1302s1c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001983
VALIDATED
PI4KA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase, catalytic, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-4959s21c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-5339s21c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001983.1-1302s21c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001983.1-6236s21c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-6236s1c1
Sequence:CCGGGCCTTGAGTGTCACAGAGCAACTCGAGTTGCTCTGTGACACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-4959s1c1
Sequence:CCGGCCAGTTTATTTGGAACATGAACTCGAGTTCATGTTCCAAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001983.1-2493s1c1
Sequence:CCGGGCTCCGAAGTACCATCATCAACTCGAGTTGATGATGGTACTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-5339s1c1
Sequence:CCGGGCGGAGTGAGTGAACTTGAAACTCGAGTTTCAAGTTCACTCACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001983.1-1302s1c1
Sequence:CCGGGCAGTCCAAGACATCCAGTAACTCGAGTTACTGGATGTCTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks