EMAIL THIS PAGE TO A FRIEND

PIGB

phosphatidylinositol glycan anchor biosynthesis, class B

Synonyms: GPI-MT-III PIG-B
UniProtKB ID: Q92521, Q53FF9, Q8WVN7
Gene ID:
Human(9488) Summary: This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene is thought to encode a member of a family of dolichol-phosphate-mannose (Dol-P-Man) dependent mannosyltransferases. [provided by RefSeq, Jul 2008]
Mouse(55981) phosphatidylinositol glycan anchor biosynthesis, class B
Rat(315807) phosphatidylinositol glycan anchor biosynthesis, class B
chicken(100858627) phosphatidylinositol glycan anchor biosynthesis, class B
domestic cat(101090523) phosphatidylinositol glycan anchor biosynthesis, class B
dog(609998) phosphatidylinositol glycan anchor biosynthesis, class B
naked mole-rat(101715263) phosphatidylinositol glycan anchor biosynthesis, class B
Domestic Rabbit(100342473) phosphatidylinositol glycan anchor biosynthesis, class B
domestic guinea pig(100721254) phosphatidylinositol glycan anchor biosynthesis, class B
cow(616044) phosphatidylinositol glycan anchor biosynthesis, class B
sheep(101105002) phosphatidylinositol glycan anchor biosynthesis, class B
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004855 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU202761 MISSION® esiRNA esiRNA targeting mouse Pigb mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004855 Rosetta Predictions human pricing
NM_001108166 Rosetta Predictions rat pricing
NM_018889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113758 predicted 841
2 SASI_Hs01_00113759 predicted 425
3 SASI_Hs01_00113760 predicted 653
4 SASI_Hs01_00113761 predicted 647
5 SASI_Hs01_00113762 predicted 1784
6 SASI_Hs01_00113763 predicted 1495
7 SASI_Hs01_00113764 predicted 668
8 SASI_Hs01_00113765 predicted 1508
9 SASI_Hs01_00113766 predicted 719
10 SASI_Hs02_00338457 predicted 1366
11 SASI_Hs01_00113767 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236004 predicted 1154
2 SASI_Rn02_00236005 predicted 1053
3 SASI_Rn02_00236006 predicted 437
4 SASI_Rn02_00236007 predicted 901
5 SASI_Rn02_00236008 predicted 1161
6 SASI_Rn02_00236009 predicted 273
7 SASI_Rn02_00236010 predicted 1828
8 SASI_Rn02_00236011 predicted 270
9 SASI_Rn02_00236012 predicted 255
10 SASI_Rn02_00236013 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188349 predicted 884
2 SASI_Mm01_00188350 predicted 399
3 SASI_Mm01_00188351 predicted 1147
4 SASI_Mm01_00188352 predicted 1135
5 SASI_Mm01_00188353 predicted 863
6 SASI_Mm01_00188354 predicted 1134
7 SASI_Mm01_00188355 predicted 405
8 SASI_Mm01_00188356 predicted 245
9 SASI_Mm01_00188357 predicted 884
10 SASI_Mm01_00188358 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018889
PIGB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-285s21c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-1489s21c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-892s21c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-428s21c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-285s1c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-1489s1c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-405s1c1
Sequence:CCGGGCGATTGAGAGGCTACACTTACTCGAGTAAGTGTAGCCTCTCAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-892s1c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-428s1c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018889
PIGB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-285s21c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-1489s21c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-892s21c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-428s21c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-285s1c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-1489s1c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-405s1c1
Sequence:CCGGGCGATTGAGAGGCTACACTTACTCGAGTAAGTGTAGCCTCTCAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-892s1c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-428s1c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018889
PIGB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-285s21c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-1489s21c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-892s21c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018889.3-428s21c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-285s1c1
Sequence:CCGGGCGAATACTTAACTGCTTCTTCTCGAGAAGAAGCAGTTAAGTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-1489s1c1
Sequence:CCGGGAAGCAGATATGTTCTACTTACTCGAGTAAGTAGAACATATCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-405s1c1
Sequence:CCGGGCGATTGAGAGGCTACACTTACTCGAGTAAGTGTAGCCTCTCAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-892s1c1
Sequence:CCGGCTGATAATTGACCGTATCTTTCTCGAGAAAGATACGGTCAATTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018889.1-428s1c1
Sequence:CCGGCCCTCATCTTCGCCAGTATTTCTCGAGAAATACTGGCGAAGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004855
VALIDATED
PIGB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-403s21c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-900s21c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1511s21c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1305s21c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-340s1c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-1242s1c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-1448s1c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004855.3-708s1c1
Sequence:CCGGCTGTAGCAGATGTGAGACTTTCTCGAGAAAGTCTCACATCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-837s1c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-355s1c1
Sequence:CCGGGCGAAAGAGAAAGTCTACCTTCTCGAGAAGGTAGACTTTCTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004855.3-1942s1c1
Sequence:CCGGGCTGGGTGGAAATATTCAGATCTCGAGATCTGAATATTTCCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004855
VALIDATED
PIGB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-403s21c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-900s21c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1511s21c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1305s21c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-340s1c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-1242s1c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-1448s1c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004855.3-708s1c1
Sequence:CCGGCTGTAGCAGATGTGAGACTTTCTCGAGAAAGTCTCACATCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-837s1c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-355s1c1
Sequence:CCGGGCGAAAGAGAAAGTCTACCTTCTCGAGAAGGTAGACTTTCTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004855.3-1942s1c1
Sequence:CCGGGCTGGGTGGAAATATTCAGATCTCGAGATCTGAATATTTCCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004855
VALIDATED
PIGB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-403s21c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-900s21c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1511s21c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004855.4-1305s21c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-340s1c1
Sequence:CCGGCGGCAAGATAAAGCTGCGAAACTCGAGTTTCGCAGCTTTATCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-1242s1c1
Sequence:CCGGGCTGCTATCTAGCACCAAAGACTCGAGTCTTTGGTGCTAGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-1448s1c1
Sequence:CCGGCTCGCCCTTTATACTGGTTTACTCGAGTAAACCAGTATAAAGGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004855.3-708s1c1
Sequence:CCGGCTGTAGCAGATGTGAGACTTTCTCGAGAAAGTCTCACATCTGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004855.3-837s1c1
Sequence:CCGGCCATGGAAACTGTTCTCACTACTCGAGTAGTGAGAACAGTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004855.3-355s1c1
Sequence:CCGGGCGAAAGAGAAAGTCTACCTTCTCGAGAAGGTAGACTTTCTCTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004855.3-1942s1c1
Sequence:CCGGGCTGGGTGGAAATATTCAGATCTCGAGATCTGAATATTTCCACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks