EMAIL THIS PAGE TO A FRIEND

PIGO

phosphatidylinositol glycan anchor biosynthesis, class O

Synonyms: HPMRS2 RP11-182N22.4
Gene ID:
Human(84720) Summary: This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(56703) phosphatidylinositol glycan anchor biosynthesis, class O
Rat(313341) phosphatidylinositol glycan anchor biosynthesis, class O
Zebrafish(563993) phosphatidylinositol glycan anchor biosynthesis, class O
Horse(100055801) phosphatidylinositol glycan anchor biosynthesis, class O
domestic cat(101088441) phosphatidylinositol glycan anchor biosynthesis, class O
dog(474754) phosphatidylinositol glycan anchor biosynthesis, class O
chicken(101665304) phosphatidylinositol glycan anchor biosynthesis, class O
chicken(101748924) phosphatidylinositol glycan anchor biosynthesis, class O
chicken(769584) phosphatidylinositol glycan anchor biosynthesis, class O
cow(783989) phosphatidylinositol glycan anchor biosynthesis, class O
sheep(101118666) phosphatidylinositol glycan anchor biosynthesis, class O
domestic guinea pig(100728242) phosphatidylinositol glycan anchor biosynthesis, class O
naked mole-rat(101713844) phosphatidylinositol glycan anchor biosynthesis, class O
Domestic Rabbit(100339282) phosphatidylinositol glycan anchor biosynthesis, class O
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032634 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032634 Rosetta Predictions human pricing
NM_152850 Rosetta Predictions human pricing
XM_001069442 Rosetta Predictions rat pricing
XM_233141 Rosetta Predictions rat pricing
NM_020035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360186 predicted 1418
2 SASI_Hs01_00223333 predicted 906
3 SASI_Hs01_00223334 predicted 614
4 SASI_Hs01_00223335 predicted 613
5 SASI_Hs01_00223336 predicted 3200
6 SASI_Hs01_00223337 predicted 873
7 SASI_Hs01_00223338 predicted 607
8 SASI_Hs01_00223339 predicted 1190
9 SASI_Hs01_00223341 predicted 829
10 SASI_Hs01_00223342 predicted 3586
11 SASI_Hs01_00223340 predicted 3373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366781 predicted 1046
2 SASI_Hs01_00167478 predicted 531
3 SASI_Hs01_00167479 predicted 242
4 SASI_Hs01_00167480 predicted 240
5 SASI_Hs01_00167481 predicted 1572
6 SASI_Hs01_00167482 predicted 506
7 SASI_Hs01_00167483 predicted 239
8 SASI_Hs01_00167484 predicted 814
9 SASI_Hs01_00167486 predicted 453
10 SASI_Hs01_00167487 predicted 1966
11 SASI_Hs01_00167485 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328084 predicted 3460
2 SASI_Rn02_00328085 predicted 571
3 SASI_Rn02_00328086 predicted 1097
4 SASI_Rn02_00328087 predicted 2622
5 SASI_Rn02_00328088 predicted 2684
6 SASI_Rn02_00328089 predicted 379
7 SASI_Rn02_00328090 predicted 590
8 SASI_Rn02_00328091 predicted 1768
9 SASI_Rn02_00328092 predicted 2567
10 SASI_Rn02_00328093 predicted 3436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387440 predicted 3462
2 SASI_Rn02_00387441 predicted 562
3 SASI_Rn02_00387442 predicted 1092
4 SASI_Rn02_00387443 predicted 2627
5 SASI_Rn02_00387444 predicted 2684
6 SASI_Rn02_00387445 predicted 378
7 SASI_Rn02_00387446 predicted 589
8 SASI_Rn02_00387447 predicted 1768
9 SASI_Rn02_00387448 predicted 2564
10 SASI_Rn02_00387449 predicted 3439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058740 predicted 2187
2 SASI_Mm01_00058741 predicted 1154
3 SASI_Mm01_00058742 predicted 1445
4 SASI_Mm01_00058743 predicted 1081
5 SASI_Mm01_00058744 predicted 1361
6 SASI_Mm01_00058745 predicted 900
7 SASI_Mm01_00058746 predicted 3154
8 SASI_Mm01_00058747 predicted 1711
9 SASI_Mm01_00058748 predicted 3486
10 SASI_Mm01_00058749 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020035
VALIDATED
PIGO MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class O
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-4093s1c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020035.1-3222s1c1
Sequence:CCGGCCACTTATGCTGTTGCATGTACTCGAGTACATGCAACAGCATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3065s1c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3063s1c1
Sequence:CCGGCTCGACTATGTAGTCCCACAACTCGAGTTGTGGGACTACATAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-1837s1c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-1837s21c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-3065s21c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-4093s21c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-2321s21c1
Sequence:CCGGCCCTAGACCTGTCCTAATATTCTCGAGAATATTAGGACAGGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020035
VALIDATED
PIGO MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class O
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-4093s1c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020035.1-3222s1c1
Sequence:CCGGCCACTTATGCTGTTGCATGTACTCGAGTACATGCAACAGCATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3065s1c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3063s1c1
Sequence:CCGGCTCGACTATGTAGTCCCACAACTCGAGTTGTGGGACTACATAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-1837s1c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-1837s21c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-3065s21c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-4093s21c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-2321s21c1
Sequence:CCGGCCCTAGACCTGTCCTAATATTCTCGAGAATATTAGGACAGGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020035
VALIDATED
PIGO MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class O
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-4093s1c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020035.1-3222s1c1
Sequence:CCGGCCACTTATGCTGTTGCATGTACTCGAGTACATGCAACAGCATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3065s1c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-3063s1c1
Sequence:CCGGCTCGACTATGTAGTCCCACAACTCGAGTTGTGGGACTACATAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020035.1-1837s1c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-1837s21c1
Sequence:CCGGCGACTCAGGATCTCCAAGTTACTCGAGTAACTTGGAGATCCTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020035.2-3065s21c1
Sequence:CCGGCGACTATGTAGTCCCACAAATCTCGAGATTTGTGGGACTACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-4093s21c1
Sequence:CCGGGCTCAACTCTGGGACTTTATTCTCGAGAATAAAGTCCCAGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_020035.2-2321s21c1
Sequence:CCGGCCCTAGACCTGTCCTAATATTCTCGAGAATATTAGGACAGGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032634
VALIDATED
PIGO MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class O
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2386s1c1
Sequence:CCGGCGAGCCAAGAATTTGTGGTATCTCGAGATACCACAAATTCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032634.2-830s1c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-1395s1c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2787s1c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3629s21c1
Sequence:CCGGCCTGGTTCAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-1395s21c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-2787s21c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-830s21c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3889s21c1
Sequence:CCGGGCGGTCTCCGAAGTGGAATAACTCGAGTTATTCCACTTCGGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032634
VALIDATED
PIGO MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class O
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2386s1c1
Sequence:CCGGCGAGCCAAGAATTTGTGGTATCTCGAGATACCACAAATTCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032634.2-830s1c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-1395s1c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2787s1c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3629s21c1
Sequence:CCGGCCTGGTTCAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-1395s21c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-2787s21c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-830s21c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3889s21c1
Sequence:CCGGGCGGTCTCCGAAGTGGAATAACTCGAGTTATTCCACTTCGGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032634
VALIDATED
PIGO MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class O
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2386s1c1
Sequence:CCGGCGAGCCAAGAATTTGTGGTATCTCGAGATACCACAAATTCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032634.2-830s1c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-1395s1c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032634.2-2787s1c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3629s21c1
Sequence:CCGGCCTGGTTCAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-1395s21c1
Sequence:CCGGGCCCATCCCATTTGGGAATATCTCGAGATATTCCCAAATGGGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-2787s21c1
Sequence:CCGGCCCTCAAATCTACCGACACATCTCGAGATGTGTCGGTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032634.2-830s21c1
Sequence:CCGGCCTTTATTGATGCTGGTAGTACTCGAGTACTACCAGCATCAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032634.2-3889s21c1
Sequence:CCGGGCGGTCTCCGAAGTGGAATAACTCGAGTTATTCCACTTCGGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks