EMAIL THIS PAGE TO A FRIEND

PIGP

phosphatidylinositol glycan anchor biosynthesis, class P

Synonyms: DCRC DCRC-S DSCR5 DSRC
Gene ID:
Human(51227) Summary: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(56176) phosphatidylinositol glycan anchor biosynthesis, class P
Rat(288238) phosphatidylinositol glycan anchor biosynthesis, class P
naked mole-rat(101721784) phosphatidylinositol glycan anchor biosynthesis, class P
domestic guinea pig(100715662) phosphatidylinositol glycan anchor biosynthesis, class P
cow(767951) phosphatidylinositol glycan anchor biosynthesis, class P
Zebrafish(325316) phosphatidylinositol glycan, class P
dog(478413) phosphatidylinositol glycan anchor biosynthesis, class P
chicken(418517) phosphatidylinositol glycan anchor biosynthesis, class P
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153681 Rosetta Predictions human pricing
NM_153682 Rosetta Predictions human pricing
NM_001099758 Rosetta Predictions rat pricing
NM_019543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019522 predicted 621
2 SASI_Hs01_00019523 predicted 511
3 SASI_Hs01_00019524 predicted 544
4 SASI_Hs01_00019525 predicted 535
5 SASI_Hs01_00019526 predicted 463
6 SASI_Hs01_00019527 predicted 659
7 SASI_Hs01_00019528 predicted 501
8 SASI_Hs02_00367396 predicted 494
9 SASI_Hs01_00019529 predicted 663
10 SASI_Hs01_00019530 predicted 658
11 SASI_Hs01_00019531 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139483 predicted 514
2 SASI_Hs01_00139484 predicted 404
3 SASI_Hs02_00367397 predicted 387
4 SASI_Hs01_00139485 predicted 434
5 SASI_Hs01_00139486 predicted 430
6 SASI_Hs01_00139487 predicted 356
7 SASI_Hs01_00139488 predicted 556
8 SASI_Hs01_00139489 predicted 387
9 SASI_Hs01_00139490 predicted 392
10 SASI_Hs01_00139491 predicted 557
11 SASI_Hs01_00139492 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209764 predicted 227
2 SASI_Rn02_00209765 predicted 220
3 SASI_Rn02_00209766 predicted 201
4 SASI_Rn02_00209767 predicted 225
5 SASI_Rn02_00209768 predicted 225
6 SASI_Rn02_00209769 predicted 302
7 SASI_Rn02_00209770 predicted 307
8 SASI_Rn02_00209771 predicted 204
9 SASI_Rn02_00209772 predicted 202
10 SASI_Rn02_00209773 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140079 predicted 615
2 SASI_Mm01_00140081 predicted 402
3 SASI_Mm01_00140082 predicted 419
4 SASI_Mm01_00140083 predicted 475
5 SASI_Mm02_00324586 predicted 645
6 SASI_Mm01_00140084 predicted 369
7 SASI_Mm01_00140085 predicted 517
8 SASI_Mm01_00140086 predicted 416
9 SASI_Mm01_00140087 predicted 420
10 SASI_Mm01_00140088 predicted 564
11 SASI_Mm01_00140080 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019543
VALIDATED
PIGP MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class P
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-326s21c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-401s21c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-248s21c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019543.3-549s21c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-486s21c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-714s1c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-491s1c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-651s1c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019543.2-413s1c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-566s1c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019543
VALIDATED
PIGP MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class P
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-326s21c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-401s21c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-248s21c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019543.3-549s21c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-486s21c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-714s1c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-491s1c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-651s1c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019543.2-413s1c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-566s1c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019543
VALIDATED
PIGP MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class P
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-326s21c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-401s21c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-248s21c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019543.3-549s21c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019543.3-486s21c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-714s1c1
Sequence:CCGGGCTGTGTATAAACATCCTAAACTCGAGTTTAGGATGTTTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-491s1c1
Sequence:CCGGCCTCCTTATCACAGTTGTAATCTCGAGATTACAACTGTGATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-651s1c1
Sequence:CCGGCCCATTAGTGAAGTAAACAAACTCGAGTTTGTTTACTTCACTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019543.2-413s1c1
Sequence:CCGGCGTTCCCGAATCTTGGTTAAACTCGAGTTTAACCAAGATTCGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019543.2-566s1c1
Sequence:CCGGCATTCATACGATCACAGATAACTCGAGTTATCTGTGATCGTATGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153681
VALIDATED
PIGP MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class P
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153681.2-501s21c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-554s21c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-710s21c1
Sequence:CCGGGTAACACCAAGCACGTATTTACTCGAGTAAATACGTGCTTGGTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-313s21c1
Sequence:CCGGTTGCCAGAAAGAGCGATTTATCTCGAGATAAATCGCTCTTTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-614s21c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153681
VALIDATED
PIGP MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class P
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153681.2-501s21c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-554s21c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-710s21c1
Sequence:CCGGGTAACACCAAGCACGTATTTACTCGAGTAAATACGTGCTTGGTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-313s21c1
Sequence:CCGGTTGCCAGAAAGAGCGATTTATCTCGAGATAAATCGCTCTTTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-614s21c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153681
VALIDATED
PIGP MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class P
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153681.2-501s21c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-554s21c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-710s21c1
Sequence:CCGGGTAACACCAAGCACGTATTTACTCGAGTAAATACGTGCTTGGTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-313s21c1
Sequence:CCGGTTGCCAGAAAGAGCGATTTATCTCGAGATAAATCGCTCTTTCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_153681.2-614s21c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016430
VALIDATED
PIGP MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class P
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016430.2-680s1c1
Sequence:CCGGCCATAGTAACACCAAGCACGTCTCGAGACGTGCTTGGTGTTACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-372s1c1
Sequence:CCGGCCTGAATCTTGGCTAAACTCTCTCGAGAGAGTTTAGCCAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-432s1c1
Sequence:CCGGGCATTACCTGTCTACCTCCTTCTCGAGAAGGAGGTAGACAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-529s1c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-476s1c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-642s1c1
Sequence:CCGGGCCAAAGAACTTTACACCAAACTCGAGTTTGGTGTAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-520s1c1
Sequence:CCGGCCATCCATACAATCACAGATACTCGAGTATCTGTGATTGTATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-589s1c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016430
VALIDATED
PIGP MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class P
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016430.2-680s1c1
Sequence:CCGGCCATAGTAACACCAAGCACGTCTCGAGACGTGCTTGGTGTTACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-372s1c1
Sequence:CCGGCCTGAATCTTGGCTAAACTCTCTCGAGAGAGTTTAGCCAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-432s1c1
Sequence:CCGGGCATTACCTGTCTACCTCCTTCTCGAGAAGGAGGTAGACAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-529s1c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-476s1c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-642s1c1
Sequence:CCGGGCCAAAGAACTTTACACCAAACTCGAGTTTGGTGTAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-520s1c1
Sequence:CCGGCCATCCATACAATCACAGATACTCGAGTATCTGTGATTGTATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-589s1c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016430
VALIDATED
PIGP MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class P
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016430.2-680s1c1
Sequence:CCGGCCATAGTAACACCAAGCACGTCTCGAGACGTGCTTGGTGTTACTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-372s1c1
Sequence:CCGGCCTGAATCTTGGCTAAACTCTCTCGAGAGAGTTTAGCCAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016430.2-432s1c1
Sequence:CCGGGCATTACCTGTCTACCTCCTTCTCGAGAAGGAGGTAGACAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-529s1c1
Sequence:CCGGCAATCACAGATAACTATGCAACTCGAGTTGCATAGTTATCTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016430.2-476s1c1
Sequence:CCGGGCTCTTGTTTGGGATTAACATCTCGAGATGTTAATCCCAAACAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-642s1c1
Sequence:CCGGGCCAAAGAACTTTACACCAAACTCGAGTTTGGTGTAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-520s1c1
Sequence:CCGGCCATCCATACAATCACAGATACTCGAGTATCTGTGATTGTATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016430.2-589s1c1
Sequence:CCGGCAGCCTTAAGAGATATTTCTACTCGAGTAGAAATATCTCTTAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks