EMAIL THIS PAGE TO A FRIEND

PIGR

polymeric immunoglobulin receptor

UniProtKB ID: P01833, Q68D81, Q8IZY7
Gene ID:
Human(5284) Summary: This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
Mouse(18703) polymeric immunoglobulin receptor
Rat(25046) polymeric immunoglobulin receptor
naked mole-rat(101725355) polymeric immunoglobulin receptor
Domestic Rabbit(100328593) polymeric immunoglobulin receptor
domestic guinea pig(100714596) polymeric immunoglobulin receptor
cow(281401) polymeric immunoglobulin receptor
sheep(100144764) polymeric immunoglobulin receptor
Zebrafish(566471) polymeric immunoglobulin receptor
Horse(100055765) polymeric immunoglobulin receptor
domestic cat(101090323) polymeric immunoglobulin receptor
dog(474357) polymeric immunoglobulin receptor
chicken(419848) polymeric immunoglobulin receptor
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072031 MISSION® esiRNA esiRNA human PIGR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002644 Rosetta Predictions human pricing
NM_012723 Rosetta Predictions rat pricing
NM_011082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162926 predicted 2209
2 SASI_Hs01_00162927 predicted 2567
3 SASI_Hs01_00162928 predicted 2287
4 SASI_Hs01_00162929 predicted 2172
5 SASI_Hs01_00162930 predicted 768
6 SASI_Hs01_00162931 predicted 1510
7 SASI_Hs01_00162932 predicted 1187
8 SASI_Hs01_00162933 predicted 258
9 SASI_Hs01_00162934 predicted 444
10 SASI_Hs01_00162935 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260060 predicted 533
2 SASI_Rn01_00031763 predicted 2210
3 SASI_Rn01_00031764 predicted 841
4 SASI_Rn01_00031765 predicted 325
5 SASI_Rn01_00031766 predicted 604
6 SASI_Rn02_00260061 predicted 1533
7 SASI_Rn01_00031767 predicted 206
8 SASI_Rn01_00031768 predicted 370
9 SASI_Rn01_00031769 predicted 1725
10 SASI_Rn02_00260062 predicted 2106
11 SASI_Rn01_00031761 predicted 2087
12 SASI_Rn01_00031762 predicted 502
13 SASI_Rn01_00031770 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021984 predicted 2128
2 SASI_Mm01_00021985 predicted 2193
3 SASI_Mm01_00021986 predicted 1768
4 SASI_Mm02_00319853 predicted 2168
5 SASI_Mm01_00021988 predicted 1910
6 SASI_Mm01_00021990 predicted 716
7 SASI_Mm01_00021991 predicted 267
8 SASI_Mm01_00021992 predicted 1418
9 SASI_Mm01_00021993 predicted 1840
10 SASI_Mm02_00319854 predicted 1787
11 SASI_Mm01_00021987 predicted 543
12 SASI_Mm01_00021989 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002644
PIGR MISSION shRNA Bacterial Glycerol Stock
polymeric immunoglobulin receptor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-399s21c1
Sequence:CCGGGCTACGTCTCCAGCAAATATGCTCGAGCATATTTGCTGGAGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-1538s21c1
Sequence:CCGGACCGTGGAGATCAAGATTATCCTCGAGGATAATCTTGATCTCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-733s1c1
Sequence:CCGGCCCAACTATACAGGAAGAATACTCGAGTATTCTTCCTGTATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-1849s1c1
Sequence:CCGGGCCGTCTATGTGGCAGTTGAACTCGAGTTCAACTGCCACATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-579s1c1
Sequence:CCGGCCTAAATGACACTAAAGTCTACTCGAGTAGACTTTAGTGTCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-450s1c1
Sequence:CCGGCGGCACATTTGTGGTGAACATCTCGAGATGTTCACCACAAATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-2282s1c1
Sequence:CCGGCTTCGATCACTCAGGAGACATCTCGAGATGTCTCCTGAGTGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002644
PIGR MISSION shRNA shRNA Plasmid DNA
polymeric immunoglobulin receptor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-399s21c1
Sequence:CCGGGCTACGTCTCCAGCAAATATGCTCGAGCATATTTGCTGGAGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-1538s21c1
Sequence:CCGGACCGTGGAGATCAAGATTATCCTCGAGGATAATCTTGATCTCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-733s1c1
Sequence:CCGGCCCAACTATACAGGAAGAATACTCGAGTATTCTTCCTGTATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-1849s1c1
Sequence:CCGGGCCGTCTATGTGGCAGTTGAACTCGAGTTCAACTGCCACATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-579s1c1
Sequence:CCGGCCTAAATGACACTAAAGTCTACTCGAGTAGACTTTAGTGTCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-450s1c1
Sequence:CCGGCGGCACATTTGTGGTGAACATCTCGAGATGTTCACCACAAATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-2282s1c1
Sequence:CCGGCTTCGATCACTCAGGAGACATCTCGAGATGTCTCCTGAGTGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002644
PIGR MISSION shRNA Lentiviral Transduction Particles
polymeric immunoglobulin receptor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-399s21c1
Sequence:CCGGGCTACGTCTCCAGCAAATATGCTCGAGCATATTTGCTGGAGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002644.3-1538s21c1
Sequence:CCGGACCGTGGAGATCAAGATTATCCTCGAGGATAATCTTGATCTCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-733s1c1
Sequence:CCGGCCCAACTATACAGGAAGAATACTCGAGTATTCTTCCTGTATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-1849s1c1
Sequence:CCGGGCCGTCTATGTGGCAGTTGAACTCGAGTTCAACTGCCACATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-579s1c1
Sequence:CCGGCCTAAATGACACTAAAGTCTACTCGAGTAGACTTTAGTGTCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-450s1c1
Sequence:CCGGCGGCACATTTGTGGTGAACATCTCGAGATGTTCACCACAAATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002644.2-2282s1c1
Sequence:CCGGCTTCGATCACTCAGGAGACATCTCGAGATGTCTCCTGAGTGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011082
PIGR MISSION shRNA Bacterial Glycerol Stock
polymeric immunoglobulin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011082.2-2856s1c1
Sequence:CCGGCCAGGCCACAATCTTTCTATACTCGAGTATAGAAAGATTGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1417s1c1
Sequence:CCGGCTGGCTTCTATTGGTGTCTTACTCGAGTAAGACACCAATAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-2249s1c1
Sequence:CCGGGCAAACAGTCATCGAAGGAAACTCGAGTTTCCTTCGATGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-710s1c1
Sequence:CCGGCCTAACTGTATTCTATGTCAACTCGAGTTGACATAGAATACAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1416s1c1
Sequence:CCGGGCTGGCTTCTATTGGTGTCTTCTCGAGAAGACACCAATAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011082
PIGR MISSION shRNA shRNA Plasmid DNA
polymeric immunoglobulin receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011082.2-2856s1c1
Sequence:CCGGCCAGGCCACAATCTTTCTATACTCGAGTATAGAAAGATTGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1417s1c1
Sequence:CCGGCTGGCTTCTATTGGTGTCTTACTCGAGTAAGACACCAATAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-2249s1c1
Sequence:CCGGGCAAACAGTCATCGAAGGAAACTCGAGTTTCCTTCGATGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-710s1c1
Sequence:CCGGCCTAACTGTATTCTATGTCAACTCGAGTTGACATAGAATACAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1416s1c1
Sequence:CCGGGCTGGCTTCTATTGGTGTCTTCTCGAGAAGACACCAATAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011082
PIGR MISSION shRNA Lentiviral Transduction Particles
polymeric immunoglobulin receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011082.2-2856s1c1
Sequence:CCGGCCAGGCCACAATCTTTCTATACTCGAGTATAGAAAGATTGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1417s1c1
Sequence:CCGGCTGGCTTCTATTGGTGTCTTACTCGAGTAAGACACCAATAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-2249s1c1
Sequence:CCGGGCAAACAGTCATCGAAGGAAACTCGAGTTTCCTTCGATGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-710s1c1
Sequence:CCGGCCTAACTGTATTCTATGTCAACTCGAGTTGACATAGAATACAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011082.2-1416s1c1
Sequence:CCGGGCTGGCTTCTATTGGTGTCTTCTCGAGAAGACACCAATAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks