EMAIL THIS PAGE TO A FRIEND

PIGY

phosphatidylinositol glycan anchor biosynthesis, class Y

Synonyms: PIG-Y
UniProtKB ID: Q3MUY2
Gene ID:
Human(84992) Summary: The protein encoded by this gene is part of the GPI-N-acetylglucosaminyltransferase (GIP-GnT) complex which initiates the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is synthesized in the endoplasmic reticulum and serves as an anchor for many surface proteins. Proteins containing GPI anchors can have an important role in cell-cell interactions. The transcript for this gene is bicistronic. The downstream open reading frame encodes this GPI-GnT complex protein, while the upstream open reading frame encodes a protein with unknown function, as represented by GeneID:100996939. [provided by RefSeq, Aug 2012]
Rat(502782) phosphatidylinositol glycan anchor biosynthesis, class Y
cow(514374) phosphatidylinositol glycan anchor biosynthesis, class Y
domestic guinea pig(100724285) phosphatidylinositol glycan anchor biosynthesis, class Y
naked mole-rat(101726015) phosphatidylinositol glycan anchor biosynthesis, class Y
chicken(101668944) phosphatidylinositol glycan anchor biosynthesis, class Y
dog(487853) phosphatidylinositol glycan anchor biosynthesis, class Y
chicken(101748971) phosphatidylinositol glycan anchor biosynthesis, class Y
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032906 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106461 MISSION® esiRNA esiRNA human PIG-Y (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042616 Rosetta Predictions human pricing
NM_032906 Rosetta Predictions human pricing
NM_001024370 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310808 predicted 719
2 SASI_Hs02_00310809 predicted 732
3 SASI_Hs02_00310810 predicted 724
4 SASI_Hs02_00310811 predicted 880
5 SASI_Hs02_00310812 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141261 predicted 721
2 SASI_Hs01_00141262 predicted 715
3 SASI_Hs01_00141263 predicted 735
4 SASI_Hs01_00141264 predicted 719
5 SASI_Hs01_00141266 predicted 722
6 SASI_Hs01_00141267 predicted 874
7 SASI_Hs01_00141265 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062805 predicted 508
2 SASI_Rn01_00062806 predicted 456
3 SASI_Rn01_00062807 predicted 408
4 SASI_Rn01_00062808 predicted 418
5 SASI_Rn01_00062809 predicted 552
6 SASI_Rn01_00062810 predicted 372
7 SASI_Rn01_00062811 predicted 309
8 SASI_Rn01_00062812 predicted 281
9 SASI_Rn01_00062813 predicted 271
10 SASI_Rn01_00062814 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032906
VALIDATED
PIGY MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class Y
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-391s1c1
Sequence:CCGGGAAGCAAGAAGAAGTGGAGCACTCGAGTGCTCCACTTCTTCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-373s1c1
Sequence:CCGGGATGACACGTCAAAGTAAGAACTCGAGTTCTTACTTTGACGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_032906.2-790s1c1
Sequence:CCGGGAAAGCTCAAATGGATGGAATCTCGAGATTCCATCCATTTGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-542s1c1
Sequence:CCGGCTGTTCTTATTCCACTGGTTTCTCGAGAAACCAGTGGAATAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-343s1c1
Sequence:CCGGGATCCCTAATATGATACCACACTCGAGTGTGGTATCATATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032906.2-330s1c1
Sequence:CCGGCAATCATTGATGGGATCCCTACTCGAGTAGGGATCCCATCAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-368s1c1
Sequence:CCGGGCTAGGATGACACGTCAAAGTCTCGAGACTTTGACGTGTCATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-329s1c1
Sequence:CCGGCCAATCATTGATGGGATCCCTCTCGAGAGGGATCCCATCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032906
VALIDATED
PIGY MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class Y
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-391s1c1
Sequence:CCGGGAAGCAAGAAGAAGTGGAGCACTCGAGTGCTCCACTTCTTCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-373s1c1
Sequence:CCGGGATGACACGTCAAAGTAAGAACTCGAGTTCTTACTTTGACGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_032906.2-790s1c1
Sequence:CCGGGAAAGCTCAAATGGATGGAATCTCGAGATTCCATCCATTTGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-542s1c1
Sequence:CCGGCTGTTCTTATTCCACTGGTTTCTCGAGAAACCAGTGGAATAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-343s1c1
Sequence:CCGGGATCCCTAATATGATACCACACTCGAGTGTGGTATCATATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032906.2-330s1c1
Sequence:CCGGCAATCATTGATGGGATCCCTACTCGAGTAGGGATCCCATCAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-368s1c1
Sequence:CCGGGCTAGGATGACACGTCAAAGTCTCGAGACTTTGACGTGTCATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-329s1c1
Sequence:CCGGCCAATCATTGATGGGATCCCTCTCGAGAGGGATCCCATCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032906
VALIDATED
PIGY MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class Y
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-391s1c1
Sequence:CCGGGAAGCAAGAAGAAGTGGAGCACTCGAGTGCTCCACTTCTTCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-373s1c1
Sequence:CCGGGATGACACGTCAAAGTAAGAACTCGAGTTCTTACTTTGACGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_032906.2-790s1c1
Sequence:CCGGGAAAGCTCAAATGGATGGAATCTCGAGATTCCATCCATTTGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-542s1c1
Sequence:CCGGCTGTTCTTATTCCACTGGTTTCTCGAGAAACCAGTGGAATAAGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-343s1c1
Sequence:CCGGGATCCCTAATATGATACCACACTCGAGTGTGGTATCATATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032906.2-330s1c1
Sequence:CCGGCAATCATTGATGGGATCCCTACTCGAGTAGGGATCCCATCAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032906.2-368s1c1
Sequence:CCGGGCTAGGATGACACGTCAAAGTCTCGAGACTTTGACGTGTCATCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032906.2-329s1c1
Sequence:CCGGCCAATCATTGATGGGATCCCTCTCGAGAGGGATCCCATCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks