EMAIL THIS PAGE TO A FRIEND

PIK3C2G

phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma

Synonyms: PI3K-C2GAMMA
UniProtKB ID: O75747, A1L3U0
Gene ID:
Human(5288) Summary: The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The biological function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(18705) phosphatidylinositol 3-kinase, C2 domain containing, gamma polypeptide
Rat(116720) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
domestic guinea pig(100713375) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
naked mole-rat(101709126) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
cow(513301) phosphoinositide-3-kinase, class 2, gamma polypeptide
sheep(101123108) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
chicken(418181) phosphoinositide-3-kinase, class 2, gamma polypeptide
dog(477681) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Horse(100064130) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
domestic cat(101084293) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004570 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023691 MISSION® esiRNA esiRNA human PIK3C2G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004570 Rosetta Predictions human pricing
NM_053923 Rosetta Predictions rat pricing
NM_011084 Rosetta Predictions mouse pricing
NM_207683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139254 predicted 2913
2 SASI_Hs01_00139255 predicted 3400
3 SASI_Hs01_00139256 predicted 2656
4 SASI_Hs02_00337900 predicted 4077
5 SASI_Hs01_00139258 predicted 626
6 SASI_Hs01_00139259 predicted 2312
7 SASI_Hs01_00139260 predicted 2548
8 SASI_Hs01_00139261 predicted 3756
9 SASI_Hs01_00139262 predicted 4101
10 SASI_Hs02_00337901 predicted 3722
11 SASI_Hs01_00139257 predicted 1279
12 SASI_Hs01_00139263 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092963 predicted 2755
2 SASI_Rn01_00092964 predicted 2793
3 SASI_Rn02_00266868 predicted 586
4 SASI_Rn01_00092965 predicted 978
5 SASI_Rn01_00092966 predicted 1332
6 SASI_Rn01_00092967 predicted 874
7 SASI_Rn01_00092968 predicted 1101
8 SASI_Rn01_00092969 predicted 4470
9 SASI_Rn01_00092970 predicted 4157
10 SASI_Rn02_00266869 predicted 1272
11 SASI_Rn01_00092962 predicted 3898
12 SASI_Rn01_00092971 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146454 predicted 707
2 SASI_Mm02_00319865 predicted 1477
3 SASI_Mm01_00146457 predicted 1566
4 SASI_Mm01_00146458 predicted 1041
5 SASI_Mm01_00146459 predicted 1358
6 SASI_Mm01_00146460 predicted 718
7 SASI_Mm02_00319866 predicted 548
8 SASI_Mm02_00319867 predicted 633
9 SASI_Mm02_00319868 predicted 1457
10 SASI_Mm02_00319869 predicted 1263
11 SASI_Mm01_00146455 predicted 454
12 SASI_Mm01_00146456 predicted 548
13 SASI_Mm01_00146461 predicted 1705
14 SASI_Mm01_00146462 predicted 566
15 SASI_Mm01_00146463 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076341 predicted 3452
2 SASI_Mm02_00352216 predicted 4218
3 SASI_Mm02_00352217 predicted 1423
4 SASI_Mm02_00352218 predicted 2269
5 SASI_Mm01_00076344 predicted 4310
6 SASI_Mm02_00352219 predicted 1954
7 SASI_Mm02_00352220 predicted 447
8 SASI_Mm02_00352221 predicted 1595
9 SASI_Mm02_00352222 predicted 2839
10 SASI_Mm01_00076349 predicted 3307
11 SASI_Mm01_00076342 predicted 3207
12 SASI_Mm01_00076343 predicted 3299
13 SASI_Mm01_00076345 predicted 3791
14 SASI_Mm01_00076346 predicted 4118
15 SASI_Mm01_00076347 predicted 3469
16 SASI_Mm01_00076348 predicted 4460
17 SASI_Mm01_00076350 predicted 4979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011084
VALIDATED
PIK3C2G MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-2030s1c1
Sequence:CCGGGACCCAACTTACAATGAAATTCTCGAGAATTTCATTGTAAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-416s1c1
Sequence:CCGGCCTCAGAGAAAGGATGTGCTACTCGAGTAGCACATCCTTTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-1732s1c1
Sequence:CCGGCGGATCTTATGAAGTTGCAAACTCGAGTTTGCAACTTCATAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2220s21c1
Sequence:CCGGAGCGTATGCATTACTGCTTAACTCGAGTTAAGCAGTAATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-568s21c1
Sequence:GTACCGGTCGCCATTGAAGATTACTTTCCTCGAGGAAAGTAATCTTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-3314s21c1
Sequence:CCGGCACACCTTAAGTCTTACTAATCTCGAGATTAGTAAGACTTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-957s21c1
Sequence:CCGGGGGAGTCTGTGACCGACATAACTCGAGTTATGTCGGTCACAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-715s21c1
Sequence:CCGGGATATGCAAATGATCACTTATCTCGAGATAAGTGATCATTTGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-534s21c1
Sequence:CCGGTCGGGATGCTTGCTCGTATTTCTCGAGAAATACGAGCAAGCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1036s21c1
Sequence:CCGGTTGGGTCATGCGCAAACATTTCTCGAGAAATGTTTGCGCATGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-504s21c1
Sequence:CCGGGAACCCGGCACTGTGCATAAACTCGAGTTTATGCACAGTGCCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2431s21c1
Sequence:CCGGTGTTGTGAATTGCAATGTAATCTCGAGATTACATTGCAATTCACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1726s21c1
Sequence:CCGGCAGGTGCTACGCGGATCTTATCTCGAGATAAGATCCGCGTAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011084
VALIDATED
PIK3C2G MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-2030s1c1
Sequence:CCGGGACCCAACTTACAATGAAATTCTCGAGAATTTCATTGTAAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-416s1c1
Sequence:CCGGCCTCAGAGAAAGGATGTGCTACTCGAGTAGCACATCCTTTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-1732s1c1
Sequence:CCGGCGGATCTTATGAAGTTGCAAACTCGAGTTTGCAACTTCATAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2220s21c1
Sequence:CCGGAGCGTATGCATTACTGCTTAACTCGAGTTAAGCAGTAATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-568s21c1
Sequence:GTACCGGTCGCCATTGAAGATTACTTTCCTCGAGGAAAGTAATCTTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-3314s21c1
Sequence:CCGGCACACCTTAAGTCTTACTAATCTCGAGATTAGTAAGACTTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-957s21c1
Sequence:CCGGGGGAGTCTGTGACCGACATAACTCGAGTTATGTCGGTCACAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-715s21c1
Sequence:CCGGGATATGCAAATGATCACTTATCTCGAGATAAGTGATCATTTGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-534s21c1
Sequence:CCGGTCGGGATGCTTGCTCGTATTTCTCGAGAAATACGAGCAAGCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1036s21c1
Sequence:CCGGTTGGGTCATGCGCAAACATTTCTCGAGAAATGTTTGCGCATGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-504s21c1
Sequence:CCGGGAACCCGGCACTGTGCATAAACTCGAGTTTATGCACAGTGCCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2431s21c1
Sequence:CCGGTGTTGTGAATTGCAATGTAATCTCGAGATTACATTGCAATTCACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1726s21c1
Sequence:CCGGCAGGTGCTACGCGGATCTTATCTCGAGATAAGATCCGCGTAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011084
VALIDATED
PIK3C2G MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-2030s1c1
Sequence:CCGGGACCCAACTTACAATGAAATTCTCGAGAATTTCATTGTAAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-416s1c1
Sequence:CCGGCCTCAGAGAAAGGATGTGCTACTCGAGTAGCACATCCTTTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011084.1-1732s1c1
Sequence:CCGGCGGATCTTATGAAGTTGCAAACTCGAGTTTGCAACTTCATAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2220s21c1
Sequence:CCGGAGCGTATGCATTACTGCTTAACTCGAGTTAAGCAGTAATGCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-568s21c1
Sequence:GTACCGGTCGCCATTGAAGATTACTTTCCTCGAGGAAAGTAATCTTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011084.2-3314s21c1
Sequence:CCGGCACACCTTAAGTCTTACTAATCTCGAGATTAGTAAGACTTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-957s21c1
Sequence:CCGGGGGAGTCTGTGACCGACATAACTCGAGTTATGTCGGTCACAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-715s21c1
Sequence:CCGGGATATGCAAATGATCACTTATCTCGAGATAAGTGATCATTTGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-534s21c1
Sequence:CCGGTCGGGATGCTTGCTCGTATTTCTCGAGAAATACGAGCAAGCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1036s21c1
Sequence:CCGGTTGGGTCATGCGCAAACATTTCTCGAGAAATGTTTGCGCATGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-504s21c1
Sequence:CCGGGAACCCGGCACTGTGCATAAACTCGAGTTTATGCACAGTGCCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011084.2-2431s21c1
Sequence:CCGGTGTTGTGAATTGCAATGTAATCTCGAGATTACATTGCAATTCACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011084.2-1726s21c1
Sequence:CCGGCAGGTGCTACGCGGATCTTATCTCGAGATAAGATCCGCGTAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004570
VALIDATED
PIK3C2G MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-3557s1c1
Sequence:CCGGCCTGGAAGCAACAAGTCATTTCTCGAGAAATGACTTGTTGCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-3461s1c1
Sequence:CCGGCCTGCTGGAAATGATGCTGTACTCGAGTACAGCATCATTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-779s1c1
Sequence:CCGGGCAGAAGAATATAGAGTCAATCTCGAGATTGACTCTATATTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004570.x-4554s1c1
Sequence:CCGGCAGGGTATTAAGGACACAGAACTCGAGTTCTGTGTCCTTAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-167s1c1
Sequence:CCGGGCAGTATGAACACCAAGAATTCTCGAGAATTCTTGGTGTTCATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4530s1c1
Sequence:CCGGGCATCTTTGTTGTCAAAGACACTCGAGTGTCTTTGACAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1361s1c1
Sequence:CCGGCCACCTGAAATACCTATTGAACTCGAGTTCAATAGGTATTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4657s1c1
Sequence:CCGGGAGTACTGATTGCATGAAATTCTCGAGAATTTCATGCAATCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1033s1c1
Sequence:CCGGGTGCTAATTATCTTGTCAAAGCTCGAGCTTTGACAAGATAATTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-1023s21c1
Sequence:CCGGTTTATGCCATGTGCTAATTATCTCGAGATAATTAGCACATGGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-4105s21c1
Sequence:CCGGCTAAGGTGCAGTTAGTCATATCTCGAGATATGACTAACTGCACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-2959s21c1
Sequence:CCGGTGGATATGCAAATGATCATTTCTCGAGAAATGATCATTTGCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004570
VALIDATED
PIK3C2G MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-3557s1c1
Sequence:CCGGCCTGGAAGCAACAAGTCATTTCTCGAGAAATGACTTGTTGCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-3461s1c1
Sequence:CCGGCCTGCTGGAAATGATGCTGTACTCGAGTACAGCATCATTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-779s1c1
Sequence:CCGGGCAGAAGAATATAGAGTCAATCTCGAGATTGACTCTATATTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004570.x-4554s1c1
Sequence:CCGGCAGGGTATTAAGGACACAGAACTCGAGTTCTGTGTCCTTAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-167s1c1
Sequence:CCGGGCAGTATGAACACCAAGAATTCTCGAGAATTCTTGGTGTTCATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4530s1c1
Sequence:CCGGGCATCTTTGTTGTCAAAGACACTCGAGTGTCTTTGACAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1361s1c1
Sequence:CCGGCCACCTGAAATACCTATTGAACTCGAGTTCAATAGGTATTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4657s1c1
Sequence:CCGGGAGTACTGATTGCATGAAATTCTCGAGAATTTCATGCAATCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1033s1c1
Sequence:CCGGGTGCTAATTATCTTGTCAAAGCTCGAGCTTTGACAAGATAATTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-1023s21c1
Sequence:CCGGTTTATGCCATGTGCTAATTATCTCGAGATAATTAGCACATGGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-4105s21c1
Sequence:CCGGCTAAGGTGCAGTTAGTCATATCTCGAGATATGACTAACTGCACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-2959s21c1
Sequence:CCGGTGGATATGCAAATGATCATTTCTCGAGAAATGATCATTTGCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004570
VALIDATED
PIK3C2G MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-3557s1c1
Sequence:CCGGCCTGGAAGCAACAAGTCATTTCTCGAGAAATGACTTGTTGCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-3461s1c1
Sequence:CCGGCCTGCTGGAAATGATGCTGTACTCGAGTACAGCATCATTTCCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004570.x-779s1c1
Sequence:CCGGGCAGAAGAATATAGAGTCAATCTCGAGATTGACTCTATATTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004570.x-4554s1c1
Sequence:CCGGCAGGGTATTAAGGACACAGAACTCGAGTTCTGTGTCCTTAATACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004570.x-167s1c1
Sequence:CCGGGCAGTATGAACACCAAGAATTCTCGAGAATTCTTGGTGTTCATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4530s1c1
Sequence:CCGGGCATCTTTGTTGTCAAAGACACTCGAGTGTCTTTGACAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1361s1c1
Sequence:CCGGCCACCTGAAATACCTATTGAACTCGAGTTCAATAGGTATTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004570.2-4657s1c1
Sequence:CCGGGAGTACTGATTGCATGAAATTCTCGAGAATTTCATGCAATCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004570.2-1033s1c1
Sequence:CCGGGTGCTAATTATCTTGTCAAAGCTCGAGCTTTGACAAGATAATTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-1023s21c1
Sequence:CCGGTTTATGCCATGTGCTAATTATCTCGAGATAATTAGCACATGGCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-4105s21c1
Sequence:CCGGCTAAGGTGCAGTTAGTCATATCTCGAGATATGACTAACTGCACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004570.4-2959s21c1
Sequence:CCGGTGGATATGCAAATGATCATTTCTCGAGAAATGATCATTTGCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks