EMAIL THIS PAGE TO A FRIEND

PIK3CB

phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta

Synonyms: P110BETA PI3K PI3KBETA PIK3C1
UniProtKB ID: P42338, D3DNF0, Q24JU2
Gene ID:
Human(5291) Summary: This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Mouse(74769) phosphatidylinositol 3-kinase, catalytic, beta polypeptide
Rat(85243) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Zebrafish(100002263) phosphoinositide-3-kinase, catalytic, beta polypeptide
chicken(424826) phosphoinositide-3-kinase, catalytic, beta polypeptide
domestic cat(101091892) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Horse(100051753) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
dog(477085) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
cow(517948) phosphoinositide-3-kinase, catalytic, beta polypeptide
sheep(101109759) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
naked mole-rat(101715249) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Domestic Rabbit(100345181) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
domestic guinea pig(100727986) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006219 Rosetta Predictions human pricing
NM_053481 Rosetta Predictions rat pricing
NM_029094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069702 predicted 1071
2 SASI_Hs01_00069703 predicted 774
3 SASI_Hs01_00069704 predicted 1990
4 SASI_Hs01_00069705 predicted 782
5 SASI_Hs01_00069706 predicted 2485
6 SASI_Hs01_00069707 predicted 2370
7 SASI_Hs02_00341131 predicted 2874
8 SASI_Hs01_00069708 predicted 194
9 SASI_Hs01_00069709 predicted 728
10 SASI_Hs01_00069711 predicted 326
11 SASI_Hs01_00069710 predicted 2686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266073 predicted 724
2 SASI_Rn01_00057422 predicted 646
3 SASI_Rn01_00057423 predicted 960
4 SASI_Rn01_00057424 predicted 794
5 SASI_Rn01_00057425 predicted 2686
6 SASI_Rn01_00057426 predicted 2985
7 SASI_Rn01_00057427 predicted 1465
8 SASI_Rn01_00057428 predicted 1729
9 SASI_Rn01_00057429 predicted 335
10 SASI_Rn02_00266074 predicted 2880
11 SASI_Rn01_00057420 predicted 2419
12 SASI_Rn01_00057421 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035645 predicted 928
2 SASI_Mm01_00035646 predicted 990
3 SASI_Mm01_00035647 predicted 962
4 SASI_Mm01_00035648 predicted 845
5 SASI_Mm01_00035649 predicted 1164
6 SASI_Mm01_00035650 predicted 3366
7 SASI_Mm01_00035651 predicted 367
8 SASI_Mm01_00035653 predicted 2103
9 SASI_Mm01_00035654 predicted 758
10 SASI_Mm02_00334860 predicted 386
11 SASI_Mm01_00035652 predicted 3265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029094
VALIDATED
PIK3CB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-465s21c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-1679s21c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2196s21c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2937s21c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-2197s1c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-466s1c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1201s1c1
Sequence:CCGGCCTTTCCAAATTACCTTGGTTCTCGAGAACCAAGGTAATTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029094.1-2938s1c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1680s1c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029094
VALIDATED
PIK3CB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-465s21c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-1679s21c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2196s21c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2937s21c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-2197s1c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-466s1c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1201s1c1
Sequence:CCGGCCTTTCCAAATTACCTTGGTTCTCGAGAACCAAGGTAATTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029094.1-2938s1c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1680s1c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029094
VALIDATED
PIK3CB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-465s21c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-1679s21c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2196s21c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029094.2-2937s21c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-2197s1c1
Sequence:CCGGGCACTTGATAATCGGAGGATTCTCGAGAATCCTCCGATTATCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-466s1c1
Sequence:CCGGGCTGTATATGAGGAACTGGAACTCGAGTTCCAGTTCCTCATATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1201s1c1
Sequence:CCGGCCTTTCCAAATTACCTTGGTTCTCGAGAACCAAGGTAATTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029094.1-2938s1c1
Sequence:CCGGGCCTCTTATGTCCTCGGCATTCTCGAGAATGCCGAGGACATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029094.1-1680s1c1
Sequence:CCGGGCACATTACGTTCCCAGAGAACTCGAGTTCTCTGGGAACGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006219
VALIDATED
PIK3CB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2720s1c1
Sequence:CCGGGCTACTGTGTAGCTTCTTATGCTCGAGCATAAGAAGCTACACAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2113s1c1
Sequence:CCGGCACATGAAAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-1265s1c1
Sequence:CCGGCCTCTAAATATCAGACCATCACTCGAGTGATGGTCTGATATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2802s1c1
Sequence:CCGGCCACATTGACTTTGGACATATCTCGAGATATGTCCAAAGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-1989s1c1
Sequence:CCGGAGCACTTGGTAATCGGAGGATCTCGAGATCCTCCGATTACCAAGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2586s1c1
Sequence:CCGGCATTCAGCTGAACAGTAGCAACTCGAGTTGCTACTGTTCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-748s1c1
Sequence:CCGGGTCAGCGGGAGAGTAGAATATCTCGAGATATTCTACTCTCCCGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1306s1c1
Sequence:CCGGTATCCTGTAGCGTGGGTAAATCTCGAGATTTACCCACGCTACAGGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-61s1c1
Sequence:CCGGATTCACAGATAGCATCTGATCTCGAGATCAGATGCTATCTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1684s1c1
Sequence:CCGGCGACAAGACTGCCGAGAGATTCTCGAGAATCTCTCGGCAGTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2289s1c1
Sequence:CCGGCCCATGTGTTATCCTCTCAGACTCGAGTCTGAGAGGATAACACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.1-784s1c1
Sequence:CCGGCCACTAATTCAGTTCCAGTATCTCGAGATACTGGAACTGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-198s1c1
Sequence:CCGGCCCAATGTTCAACCTCCTTATCTCGAGATAAGGAGGTTGAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-1316s1c1
Sequence:CCGGCGTGGGTAAATACGATGGTTTCTCGAGAAACCATCGTATTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-752s1c1
Sequence:CCGGGCGGGAGAGTAGAATATGTTTCTCGAGAAACATATTCTACTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006219
VALIDATED
PIK3CB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2720s1c1
Sequence:CCGGGCTACTGTGTAGCTTCTTATGCTCGAGCATAAGAAGCTACACAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2113s1c1
Sequence:CCGGCACATGAAAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-1265s1c1
Sequence:CCGGCCTCTAAATATCAGACCATCACTCGAGTGATGGTCTGATATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2802s1c1
Sequence:CCGGCCACATTGACTTTGGACATATCTCGAGATATGTCCAAAGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-1989s1c1
Sequence:CCGGAGCACTTGGTAATCGGAGGATCTCGAGATCCTCCGATTACCAAGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2586s1c1
Sequence:CCGGCATTCAGCTGAACAGTAGCAACTCGAGTTGCTACTGTTCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-748s1c1
Sequence:CCGGGTCAGCGGGAGAGTAGAATATCTCGAGATATTCTACTCTCCCGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1306s1c1
Sequence:CCGGTATCCTGTAGCGTGGGTAAATCTCGAGATTTACCCACGCTACAGGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-61s1c1
Sequence:CCGGATTCACAGATAGCATCTGATCTCGAGATCAGATGCTATCTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1684s1c1
Sequence:CCGGCGACAAGACTGCCGAGAGATTCTCGAGAATCTCTCGGCAGTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2289s1c1
Sequence:CCGGCCCATGTGTTATCCTCTCAGACTCGAGTCTGAGAGGATAACACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.1-784s1c1
Sequence:CCGGCCACTAATTCAGTTCCAGTATCTCGAGATACTGGAACTGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-198s1c1
Sequence:CCGGCCCAATGTTCAACCTCCTTATCTCGAGATAAGGAGGTTGAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-1316s1c1
Sequence:CCGGCGTGGGTAAATACGATGGTTTCTCGAGAAACCATCGTATTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-752s1c1
Sequence:CCGGGCGGGAGAGTAGAATATGTTTCTCGAGAAACATATTCTACTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006219
VALIDATED
PIK3CB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2720s1c1
Sequence:CCGGGCTACTGTGTAGCTTCTTATGCTCGAGCATAAGAAGCTACACAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2113s1c1
Sequence:CCGGCACATGAAAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-1265s1c1
Sequence:CCGGCCTCTAAATATCAGACCATCACTCGAGTGATGGTCTGATATTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006219.1-2802s1c1
Sequence:CCGGCCACATTGACTTTGGACATATCTCGAGATATGTCCAAAGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-1989s1c1
Sequence:CCGGAGCACTTGGTAATCGGAGGATCTCGAGATCCTCCGATTACCAAGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2586s1c1
Sequence:CCGGCATTCAGCTGAACAGTAGCAACTCGAGTTGCTACTGTTCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.x-748s1c1
Sequence:CCGGGTCAGCGGGAGAGTAGAATATCTCGAGATATTCTACTCTCCCGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1306s1c1
Sequence:CCGGTATCCTGTAGCGTGGGTAAATCTCGAGATTTACCCACGCTACAGGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-61s1c1
Sequence:CCGGATTCACAGATAGCATCTGATCTCGAGATCAGATGCTATCTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-1684s1c1
Sequence:CCGGCGACAAGACTGCCGAGAGATTCTCGAGAATCTCTCGGCAGTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.x-2289s1c1
Sequence:CCGGCCCATGTGTTATCCTCTCAGACTCGAGTCTGAGAGGATAACACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006219.1-784s1c1
Sequence:CCGGCCACTAATTCAGTTCCAGTATCTCGAGATACTGGAACTGAATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-198s1c1
Sequence:CCGGCCCAATGTTCAACCTCCTTATCTCGAGATAAGGAGGTTGAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-1316s1c1
Sequence:CCGGCGTGGGTAAATACGATGGTTTCTCGAGAAACCATCGTATTTACCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006219.1-752s1c1
Sequence:CCGGGCGGGAGAGTAGAATATGTTTCTCGAGAAACATATTCTACTCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks