EMAIL THIS PAGE TO A FRIEND

PIKFYVE

phosphoinositide kinase, FYVE finger containing

Synonyms: CFD FAB1 PIP5K PIP5K3 ZFYVE29
Gene ID:
Human(200576) Summary: Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
Mouse(18711) phosphoinositide kinase, FYVE finger containing
Rat(316457) phosphoinositide kinase, FYVE finger containing
cow(790873) phosphoinositide kinase, FYVE finger containing
sheep(101120727) phosphoinositide kinase, FYVE finger containing
naked mole-rat(101705294) phosphoinositide kinase, FYVE finger containing
domestic guinea pig(101788192) phosphoinositide kinase, FYVE finger containing
Zebrafish(337690) phosphoinositide kinase, FYVE finger containing
chicken(424114) phosphoinositide kinase, FYVE finger containing
Horse(100066445) phosphoinositide kinase, FYVE finger containing
domestic cat(101094121) phosphoinositide kinase, FYVE finger containing
dog(478890) phosphoinositide kinase, FYVE finger containing
210 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002881 Rosetta Predictions human pricing
NM_015040 Rosetta Predictions human pricing
NM_152671 Rosetta Predictions human pricing
XM_001072465 Rosetta Predictions rat pricing
XM_237217 Rosetta Predictions rat pricing
NM_011086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115719 predicted 1151
2 SASI_Hs01_00115720 predicted 1010
3 SASI_Hs01_00115721 predicted 1199
4 SASI_Hs01_00115722 predicted 1077
5 SASI_Hs01_00115723 predicted 1229
6 SASI_Hs01_00115724 predicted 1152
7 SASI_Hs01_00115725 predicted 1364
8 SASI_Hs01_00115726 predicted 1109
9 SASI_Hs01_00115727 predicted 981
10 SASI_Hs01_00115728 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090337 predicted 1319
2 SASI_Hs01_00090338 predicted 1175
3 SASI_Hs01_00090339 predicted 1101
4 SASI_Hs01_00090340 predicted 1359
5 SASI_Hs01_00090341 predicted 1041
6 SASI_Hs01_00090342 predicted 1397
7 SASI_Hs01_00090343 predicted 1004
8 SASI_Hs01_00090344 predicted 1320
9 SASI_Hs01_00090345 predicted 1278
10 SASI_Hs01_00090346 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239183 predicted 1026
2 SASI_Hs01_00239184 predicted 886
3 SASI_Hs01_00239185 predicted 815
4 SASI_Hs01_00239186 predicted 1075
5 SASI_Hs01_00239187 predicted 749
6 SASI_Hs01_00239188 predicted 1111
7 SASI_Hs01_00239189 predicted 712
8 SASI_Hs01_00239190 predicted 1029
9 SASI_Hs01_00239191 predicted 984
10 SASI_Hs01_00239192 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339288 predicted 1451
2 SASI_Rn02_00339289 predicted 3237
3 SASI_Rn02_00339290 predicted 2403
4 SASI_Rn02_00339291 predicted 5597
5 SASI_Rn02_00339292 predicted 1197
6 SASI_Rn02_00339293 predicted 4349
7 SASI_Rn02_00339294 predicted 1273
8 SASI_Rn02_00339295 predicted 5005
9 SASI_Rn02_00339296 predicted 1701
10 SASI_Rn02_00339297 predicted 4164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390757 predicted 1342
2 SASI_Rn02_00390758 predicted 932
3 SASI_Rn02_00390759 predicted 5492
4 SASI_Rn02_00390760 predicted 1101
5 SASI_Rn02_00390761 predicted 4246
6 SASI_Rn02_00390762 predicted 1164
7 SASI_Rn02_00390763 predicted 4908
8 SASI_Rn02_00390764 predicted 5243
9 SASI_Rn02_00390765 predicted 1596
10 SASI_Rn02_00390766 predicted 4062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121016 predicted 5117
2 SASI_Mm01_00121018 predicted 2515
3 SASI_Mm01_00121020 predicted 4098
4 SASI_Mm01_00121021 predicted 1928
5 SASI_Mm01_00121022 predicted 1639
6 SASI_Mm01_00121023 predicted 1040
7 SASI_Mm01_00121024 predicted 3941
8 SASI_Mm02_00319870 predicted 2373
9 SASI_Mm01_00121025 predicted 971
10 SASI_Mm02_00319871 predicted 2584
11 SASI_Mm01_00121017 predicted 3148
12 SASI_Mm01_00121019 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011086
VALIDATED
PIKFYVE MISSION shRNA Bacterial Glycerol Stock
phosphoinositide kinase, FYVE finger containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-5141s1c1
Sequence:CCGGGCCCTATTAGACTACCTGAAACTCGAGTTTCAGGTAGTCTAATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-3364s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-1688s1c1
Sequence:CCGGCCTTCATCAAAGAGTCCTTATCTCGAGATAAGGACTCTTTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-6032s1c1
Sequence:CCGGGCCACCTCATTATAGACTATTCTCGAGAATAGTCTATAATGAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011086.1-949s1c1
Sequence:CCGGGCCAGTCGTAACATATTCTTACTCGAGTAAGAATATGTTACGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-2652s21c1
Sequence:CCGGTTCGCTATGCCTCCAACATTACTCGAGTAATGTTGGAGGCATAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011086.2-6580s21c1
Sequence:CCGGGTGATTAGAGATGACTATATACTCGAGTATATAGTCATCTCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-1645s21c1
Sequence:CCGGACGATAATTTGGCTAAGTATTCTCGAGAATACTTAGCCAAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011086
VALIDATED
PIKFYVE MISSION shRNA shRNA Plasmid DNA
phosphoinositide kinase, FYVE finger containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-5141s1c1
Sequence:CCGGGCCCTATTAGACTACCTGAAACTCGAGTTTCAGGTAGTCTAATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-3364s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-1688s1c1
Sequence:CCGGCCTTCATCAAAGAGTCCTTATCTCGAGATAAGGACTCTTTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-6032s1c1
Sequence:CCGGGCCACCTCATTATAGACTATTCTCGAGAATAGTCTATAATGAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011086.1-949s1c1
Sequence:CCGGGCCAGTCGTAACATATTCTTACTCGAGTAAGAATATGTTACGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-2652s21c1
Sequence:CCGGTTCGCTATGCCTCCAACATTACTCGAGTAATGTTGGAGGCATAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011086.2-6580s21c1
Sequence:CCGGGTGATTAGAGATGACTATATACTCGAGTATATAGTCATCTCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-1645s21c1
Sequence:CCGGACGATAATTTGGCTAAGTATTCTCGAGAATACTTAGCCAAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011086
VALIDATED
PIKFYVE MISSION shRNA Lentiviral Transduction Particles
phosphoinositide kinase, FYVE finger containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-5141s1c1
Sequence:CCGGGCCCTATTAGACTACCTGAAACTCGAGTTTCAGGTAGTCTAATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-3364s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-1688s1c1
Sequence:CCGGCCTTCATCAAAGAGTCCTTATCTCGAGATAAGGACTCTTTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011086.1-6032s1c1
Sequence:CCGGGCCACCTCATTATAGACTATTCTCGAGAATAGTCTATAATGAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011086.1-949s1c1
Sequence:CCGGGCCAGTCGTAACATATTCTTACTCGAGTAAGAATATGTTACGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-2652s21c1
Sequence:CCGGTTCGCTATGCCTCCAACATTACTCGAGTAATGTTGGAGGCATAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011086.2-6580s21c1
Sequence:CCGGGTGATTAGAGATGACTATATACTCGAGTATATAGTCATCTCTAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011086.2-1645s21c1
Sequence:CCGGACGATAATTTGGCTAAGTATTCTCGAGAATACTTAGCCAAATTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015040
VALIDATED
PIKFYVE MISSION shRNA Bacterial Glycerol Stock
phosphoinositide kinase, FYVE finger containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-2713s1c1
Sequence:CCGGCGAGTTAAGGAGATCCTAATACTCGAGTATTAGGATCTCCTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3877s1c1
Sequence:CCGGCCTTGGATTGTAACAATGGAACTCGAGTTCCATTGTTACAATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3526s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-6277s1c1
Sequence:CCGGCGAACATTTACATGGGACAAACTCGAGTTTGTCCCATGTAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-473s1c1
Sequence:CCGGCTTCAGCATTAGACACAAGAACTCGAGTTCTTGTGTCTAATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-1447s1c1
Sequence:CCGGGAGATGAGTATGCGCTGTATACTCGAGTATACAGCGCATACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015040.2-7194s1c1
Sequence:CCGGCTTACTTGCATACGCTCATATCTCGAGATATGAGCGTATGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-7108s1c1
Sequence:CCGGGCTACAGCAATTAACTTTAAGCTCGAGCTTAAAGTTAATTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015040.2-1609s1c1
Sequence:CCGGGTGACGATAATTTGGCTAATTCTCGAGAATTAGCCAAATTATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015040.3-1338s21c1
Sequence:CCGGCTAATCCGAAATGGGCATATTCTCGAGAATATGCCCATTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015040.3-6809s21c1
Sequence:CCGGGACTATCCTGGCATCACATTTCTCGAGAAATGTGATGCCAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015040
VALIDATED
PIKFYVE MISSION shRNA shRNA Plasmid DNA
phosphoinositide kinase, FYVE finger containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-2713s1c1
Sequence:CCGGCGAGTTAAGGAGATCCTAATACTCGAGTATTAGGATCTCCTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3877s1c1
Sequence:CCGGCCTTGGATTGTAACAATGGAACTCGAGTTCCATTGTTACAATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3526s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-6277s1c1
Sequence:CCGGCGAACATTTACATGGGACAAACTCGAGTTTGTCCCATGTAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-473s1c1
Sequence:CCGGCTTCAGCATTAGACACAAGAACTCGAGTTCTTGTGTCTAATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-1447s1c1
Sequence:CCGGGAGATGAGTATGCGCTGTATACTCGAGTATACAGCGCATACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015040.2-7194s1c1
Sequence:CCGGCTTACTTGCATACGCTCATATCTCGAGATATGAGCGTATGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-7108s1c1
Sequence:CCGGGCTACAGCAATTAACTTTAAGCTCGAGCTTAAAGTTAATTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015040.2-1609s1c1
Sequence:CCGGGTGACGATAATTTGGCTAATTCTCGAGAATTAGCCAAATTATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015040.3-1338s21c1
Sequence:CCGGCTAATCCGAAATGGGCATATTCTCGAGAATATGCCCATTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015040.3-6809s21c1
Sequence:CCGGGACTATCCTGGCATCACATTTCTCGAGAAATGTGATGCCAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015040
VALIDATED
PIKFYVE MISSION shRNA Lentiviral Transduction Particles
phosphoinositide kinase, FYVE finger containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-2713s1c1
Sequence:CCGGCGAGTTAAGGAGATCCTAATACTCGAGTATTAGGATCTCCTTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3877s1c1
Sequence:CCGGCCTTGGATTGTAACAATGGAACTCGAGTTCCATTGTTACAATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-3526s1c1
Sequence:CCGGGCCAAGTCTATTCAAGTCTTACTCGAGTAAGACTTGAATAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-6277s1c1
Sequence:CCGGCGAACATTTACATGGGACAAACTCGAGTTTGTCCCATGTAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_015040.1-473s1c1
Sequence:CCGGCTTCAGCATTAGACACAAGAACTCGAGTTCTTGTGTCTAATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-1447s1c1
Sequence:CCGGGAGATGAGTATGCGCTGTATACTCGAGTATACAGCGCATACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015040.2-7194s1c1
Sequence:CCGGCTTACTTGCATACGCTCATATCTCGAGATATGAGCGTATGCAAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015040.2-7108s1c1
Sequence:CCGGGCTACAGCAATTAACTTTAAGCTCGAGCTTAAAGTTAATTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015040.2-1609s1c1
Sequence:CCGGGTGACGATAATTTGGCTAATTCTCGAGAATTAGCCAAATTATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015040.3-1338s21c1
Sequence:CCGGCTAATCCGAAATGGGCATATTCTCGAGAATATGCCCATTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015040.3-6809s21c1
Sequence:CCGGGACTATCCTGGCATCACATTTCTCGAGAAATGTGATGCCAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks