EMAIL THIS PAGE TO A FRIEND

PIP4K2B

phosphatidylinositol-5-phosphate 4-kinase, type II, beta

Synonyms: PI5P4KB PIP5K2B PIP5KIIB PIP5KIIbeta
UniProtKB ID: P78356, Q5U0E8, Q8TBP2
Gene ID:
Human(8396) Summary: The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]
Mouse(108083) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Rat(89812) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
chicken(419999) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
dog(491034) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
domestic cat(101100097) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Horse(100055236) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
cow(539211) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
sheep(101120849) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
domestic guinea pig(100725726) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
naked mole-rat(101719792) phosphatidylinositol-5-phosphate 4-kinase, type II, beta
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003559 siRNAs that have been validated in the lab human pricing
NM_138687 Rosetta Predictions human pricing
NM_053550 Rosetta Predictions rat pricing
NM_054051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003559 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186315 validated 715
1 SASI_Hs01_00186318 validated 1018
2 SASI_Hs02_00335844 predicted 1880
3 SASI_Hs01_00186317 predicted 710
4 SASI_Hs02_00335845 predicted 1973
5 SASI_Hs02_00335846 predicted 1666
6 SASI_Hs02_00335847 predicted 1781
7 SASI_Hs02_00335848 predicted 1712
8 SASI_Hs02_00335849 predicted 1067
9 SASI_Hs02_00335850 predicted 1085
10 SASI_Hs01_00186316 predicted 894
11 SASI_Hs01_00186319 predicted 952
12 SASI_Hs01_00186320 predicted 740
13 SASI_Hs01_00186321 predicted 954
14 SASI_Hs01_00186322 predicted 905
15 SASI_Hs01_00186323 predicted 911
16 SASI_Hs01_00186324 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087220 predicted 714
2 SASI_Hs01_00087221 predicted 892
3 SASI_Hs01_00087222 predicted 717
4 SASI_Hs01_00087223 predicted 1024
5 SASI_Hs01_00087224 predicted 949
6 SASI_Hs01_00087225 predicted 745
7 SASI_Hs01_00087226 predicted 960
8 SASI_Hs01_00087227 predicted 907
9 SASI_Hs01_00087228 predicted 901
10 SASI_Hs01_00087229 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038169 predicted 345
2 SASI_Rn01_00038170 predicted 1178
3 SASI_Rn02_00266202 predicted 1190
4 SASI_Rn01_00038171 predicted 601
5 SASI_Rn01_00038172 predicted 319
6 SASI_Rn01_00038173 predicted 1363
7 SASI_Rn01_00038174 predicted 1216
8 SASI_Rn01_00038175 predicted 327
9 SASI_Rn02_00266203 predicted 854
10 SASI_Rn01_00038176 predicted 638
11 SASI_Rn01_00038177 predicted 740
12 SASI_Rn01_00038178 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033477 predicted 330
2 SASI_Mm01_00033478 predicted 300
3 SASI_Mm01_00033480 predicted 593
4 SASI_Mm01_00033481 predicted 794
5 SASI_Mm01_00033482 predicted 1169
6 SASI_Mm01_00033483 predicted 539
7 SASI_Mm01_00033484 predicted 323
8 SASI_Mm01_00033485 predicted 1336
9 SASI_Mm01_00033486 predicted 715
10 SASI_Mm02_00337962 predicted 520
11 SASI_Mm01_00033479 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003559
VALIDATED
PIP4K2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1175s1c1
Sequence:CCGGGCCAAGGACTTGCCAACATTCCTCGAGGAATGTTGGCAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1064s1c1
Sequence:CCGGGAAACCTACATGGTGGTTACCCTCGAGGGTAACCACCATGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2634s1c1
Sequence:CCGGCCCTCATGTTTAAATGGTTATCTCGAGATAACCATTTAAACATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-986s1c1
Sequence:CCGGCAGTTTATAGTGGAGTGTCATCTCGAGATGACACTCCACTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-705s1c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2704s1c1
Sequence:CCGGCCCTCGATCTATTTCCTTCTTCTCGAGAAGAAGGAAATAGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-668s1c1
Sequence:CCGGCCTGTCATGCTAATGCCAGATCTCGAGATCTGGCATTAGCATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1693s1c1
Sequence:CCGGCAAACGCTTCAACGAGTTTATCTCGAGATAAACTCGTTGAAGCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1597s1c1
Sequence:CCGGGCCATACGATACAAAGAAGAACTCGAGTTCTTCTTTGTATCGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1114s1c1
Sequence:CCGGGCATCGCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003559.4-2053s21c1
Sequence:GTACCGGGATGACTTCGTGGGTTTATTTCTCGAGAAATAAACCCACGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-1107s21c1
Sequence:GTACCGGTCACTGTGCATCGCAAGTATGCTCGAGCATACTTGCGATGCACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-757s21c1
Sequence:GTACCGGCTTTAAGTTTAAGGAGTATTGCTCGAGCAATACTCCTTAAACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1692s21c1
Sequence:CCGGCCAAACGCTTCAACGAGTTTACTCGAGTAAACTCGTTGAAGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-705s21c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-661s21c1
Sequence:CCGGTCCTGTTCCTGTCATGCTAATCTCGAGATTAGCATGACAGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1592s21c1
Sequence:CCGGCTCACGCCATACGATACAAAGCTCGAGCTTTGTATCGTATGGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1789s21c1
Sequence:CCGGGTTAGGGAGAAGGGTGTATTTCTCGAGAAATACACCCTTCTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003559
VALIDATED
PIP4K2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1175s1c1
Sequence:CCGGGCCAAGGACTTGCCAACATTCCTCGAGGAATGTTGGCAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1064s1c1
Sequence:CCGGGAAACCTACATGGTGGTTACCCTCGAGGGTAACCACCATGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2634s1c1
Sequence:CCGGCCCTCATGTTTAAATGGTTATCTCGAGATAACCATTTAAACATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-986s1c1
Sequence:CCGGCAGTTTATAGTGGAGTGTCATCTCGAGATGACACTCCACTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-705s1c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2704s1c1
Sequence:CCGGCCCTCGATCTATTTCCTTCTTCTCGAGAAGAAGGAAATAGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-668s1c1
Sequence:CCGGCCTGTCATGCTAATGCCAGATCTCGAGATCTGGCATTAGCATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1693s1c1
Sequence:CCGGCAAACGCTTCAACGAGTTTATCTCGAGATAAACTCGTTGAAGCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1597s1c1
Sequence:CCGGGCCATACGATACAAAGAAGAACTCGAGTTCTTCTTTGTATCGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1114s1c1
Sequence:CCGGGCATCGCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003559.4-2053s21c1
Sequence:GTACCGGGATGACTTCGTGGGTTTATTTCTCGAGAAATAAACCCACGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-1107s21c1
Sequence:GTACCGGTCACTGTGCATCGCAAGTATGCTCGAGCATACTTGCGATGCACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-757s21c1
Sequence:GTACCGGCTTTAAGTTTAAGGAGTATTGCTCGAGCAATACTCCTTAAACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1692s21c1
Sequence:CCGGCCAAACGCTTCAACGAGTTTACTCGAGTAAACTCGTTGAAGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-705s21c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-661s21c1
Sequence:CCGGTCCTGTTCCTGTCATGCTAATCTCGAGATTAGCATGACAGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1592s21c1
Sequence:CCGGCTCACGCCATACGATACAAAGCTCGAGCTTTGTATCGTATGGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1789s21c1
Sequence:CCGGGTTAGGGAGAAGGGTGTATTTCTCGAGAAATACACCCTTCTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003559
VALIDATED
PIP4K2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1175s1c1
Sequence:CCGGGCCAAGGACTTGCCAACATTCCTCGAGGAATGTTGGCAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1064s1c1
Sequence:CCGGGAAACCTACATGGTGGTTACCCTCGAGGGTAACCACCATGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2634s1c1
Sequence:CCGGCCCTCATGTTTAAATGGTTATCTCGAGATAACCATTTAAACATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-986s1c1
Sequence:CCGGCAGTTTATAGTGGAGTGTCATCTCGAGATGACACTCCACTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-705s1c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003559.3-2704s1c1
Sequence:CCGGCCCTCGATCTATTTCCTTCTTCTCGAGAAGAAGGAAATAGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-668s1c1
Sequence:CCGGCCTGTCATGCTAATGCCAGATCTCGAGATCTGGCATTAGCATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1693s1c1
Sequence:CCGGCAAACGCTTCAACGAGTTTATCTCGAGATAAACTCGTTGAAGCGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1597s1c1
Sequence:CCGGGCCATACGATACAAAGAAGAACTCGAGTTCTTCTTTGTATCGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003559.3-1114s1c1
Sequence:CCGGGCATCGCAAGTATGACCTCAACTCGAGTTGAGGTCATACTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003559.4-2053s21c1
Sequence:GTACCGGGATGACTTCGTGGGTTTATTTCTCGAGAAATAAACCCACGAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-1107s21c1
Sequence:GTACCGGTCACTGTGCATCGCAAGTATGCTCGAGCATACTTGCGATGCACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003559.4-757s21c1
Sequence:GTACCGGCTTTAAGTTTAAGGAGTATTGCTCGAGCAATACTCCTTAAACTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1692s21c1
Sequence:CCGGCCAAACGCTTCAACGAGTTTACTCGAGTAAACTCGTTGAAGCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-705s21c1
Sequence:CCGGGCAAGATCAAGGTGGACAATCCTCGAGGATTGTCCACCTTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-661s21c1
Sequence:CCGGTCCTGTTCCTGTCATGCTAATCTCGAGATTAGCATGACAGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1592s21c1
Sequence:CCGGCTCACGCCATACGATACAAAGCTCGAGCTTTGTATCGTATGGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003559.4-1789s21c1
Sequence:CCGGGTTAGGGAGAAGGGTGTATTTCTCGAGAAATACACCCTTCTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054051
VALIDATED
PIP4K2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-733s1c1
Sequence:CCGGGCATCGCAAATACGACCTGAACTCGAGTTCAGGTCGTATTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-1171s1c1
Sequence:CCGGCCCTAAGAAGGAGGTCTATTTCTCGAGAAATAGACCTCCTTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-1321s1c1
Sequence:CCGGCAACGAGTTCATGTCCAACATCTCGAGATGTTGGACATGAACTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-220s1c1
Sequence:CCGGGCCGATTCTCAGCGTCCTGATCTCGAGATCAGGACGCTGAGAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-323s1c1
Sequence:CCGGAGCAAGATCAAGGTGGACAATCTCGAGATTGTCCACCTTGATCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-613s21c1
Sequence:CCGGAGTGGAATGTCACGGCAATACCTCGAGGTATTGCCGTGACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-246s21c1
Sequence:CCGGGGGTGAACCACACGATCAATGCTCGAGCATTGATCGTGTGGTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-723s21c1
Sequence:CCGGGGCTTACTGTGCATCGCAAATCTCGAGATTTGCGATGCACAGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054051.1-1172s21c1
Sequence:CCGGCCTAAGAAGGAGGTCTATTTCCTCGAGGAAATAGACCTCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054051
VALIDATED
PIP4K2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-733s1c1
Sequence:CCGGGCATCGCAAATACGACCTGAACTCGAGTTCAGGTCGTATTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-1171s1c1
Sequence:CCGGCCCTAAGAAGGAGGTCTATTTCTCGAGAAATAGACCTCCTTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-1321s1c1
Sequence:CCGGCAACGAGTTCATGTCCAACATCTCGAGATGTTGGACATGAACTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-220s1c1
Sequence:CCGGGCCGATTCTCAGCGTCCTGATCTCGAGATCAGGACGCTGAGAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-323s1c1
Sequence:CCGGAGCAAGATCAAGGTGGACAATCTCGAGATTGTCCACCTTGATCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-613s21c1
Sequence:CCGGAGTGGAATGTCACGGCAATACCTCGAGGTATTGCCGTGACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-246s21c1
Sequence:CCGGGGGTGAACCACACGATCAATGCTCGAGCATTGATCGTGTGGTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-723s21c1
Sequence:CCGGGGCTTACTGTGCATCGCAAATCTCGAGATTTGCGATGCACAGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054051.1-1172s21c1
Sequence:CCGGCCTAAGAAGGAGGTCTATTTCCTCGAGGAAATAGACCTCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054051
VALIDATED
PIP4K2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-733s1c1
Sequence:CCGGGCATCGCAAATACGACCTGAACTCGAGTTCAGGTCGTATTTGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-1171s1c1
Sequence:CCGGCCCTAAGAAGGAGGTCTATTTCTCGAGAAATAGACCTCCTTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-1321s1c1
Sequence:CCGGCAACGAGTTCATGTCCAACATCTCGAGATGTTGGACATGAACTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054051.1-220s1c1
Sequence:CCGGGCCGATTCTCAGCGTCCTGATCTCGAGATCAGGACGCTGAGAATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054051.1-323s1c1
Sequence:CCGGAGCAAGATCAAGGTGGACAATCTCGAGATTGTCCACCTTGATCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-613s21c1
Sequence:CCGGAGTGGAATGTCACGGCAATACCTCGAGGTATTGCCGTGACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-246s21c1
Sequence:CCGGGGGTGAACCACACGATCAATGCTCGAGCATTGATCGTGTGGTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054051.1-723s21c1
Sequence:CCGGGGCTTACTGTGCATCGCAAATCTCGAGATTTGCGATGCACAGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054051.1-1172s21c1
Sequence:CCGGCCTAAGAAGGAGGTCTATTTCCTCGAGGAAATAGACCTCCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks